si:dkey-172j4.3

Ensembl ID:
ENSDARG00000074183
ZFIN ID:
ZDB-GENE-081104-24
Description:
Novel protein similar to vetebrate diacylglycerol kinase, delta 130kDa (DGKD) [Source:UniProtKB/TrEM
Human Orthologue:
DGKH
Human Description:
diacylglycerol kinase, eta [Source:HGNC Symbol;Acc:2854]
Mouse Orthologue:
Dgkh
Mouse Description:
diacylglycerol kinase, eta Gene [Source:MGI Symbol;Acc:MGI:2444188]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11908 Nonsense Available for shipment Available now
sa38605 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31567 Nonsense Available for shipment Available now
sa40878 Nonsense Mutation detected in F1 DNA During 2017
sa18053 Nonsense Available for shipment Available now
sa34055 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11908
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049885 Nonsense 153 1074 4 28
ENSDART00000134535 Nonsense 93 1014 3 27
Genomic Location (Zv9):
Chromosome 7 (position 24850932)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23412684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCAGGAAGGAGATGGAAGACTGGATCAGTGCTTTGAAGTCTGTACAG[A/T]AATGGGAAACATACGAGGTCTGAACCTTCWCTTTTCACCTTTGGAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38605
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049885 Essential Splice Site 159 1074 5 28
ENSDART00000134535 Essential Splice Site 99 1014 4 27
Genomic Location (Zv9):
Chromosome 7 (position 24853421)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23415173
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTTGAATATTTATAGCACACTGATGCTGACACGATTTGTCTGATTCC[A/G]GGCCAGTCAGTTCAACATGGAGCACTTCTCCGGGATGCATAACTGGTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31567
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049885 Nonsense 207 1074 6 28
ENSDART00000134535 Nonsense 147 1014 5 27
Genomic Location (Zv9):
Chromosome 7 (position 24853841)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23415593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTCATTTCATCCCATCTCCCTGTTTGTGTGTGTTAGTGTGTAAGTTC[A/T]AAGCCCACAAGCGCTGTGCCGTACGATCCACCAATACCTGTAAATGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049885 Nonsense 246 1074 7 28
ENSDART00000134535 Nonsense 186 1014 6 27
Genomic Location (Zv9):
Chromosome 7 (position 24855706)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23417458
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTAAATGTGTGTGTCTGTGTGTGCAGGTGTCAATGCCTCACCAGTGGT[T/A]GGAGGGAAACCTGCCGGTCAGCGCTAAGTGTGTGGTGTGCGATCGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18053
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049885 Nonsense 881 1074 23 28
ENSDART00000134535 Nonsense 821 1014 22 27
Genomic Location (Zv9):
Chromosome 7 (position 24880489)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23442241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACGCTGAARTCATGGGAGGACAAGCGTAAAGGTGACAGCCGGCCRTCT[C/T]GACCACGACTCAACTCCCAACAGTCTATGGAGTAYCTGACGGAGGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049885 Nonsense 887 1074 23 28
ENSDART00000134535 Nonsense 827 1014 22 27
Genomic Location (Zv9):
Chromosome 7 (position 24880507)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23442259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACAAGCGTAAAGGTGACAGCCGGCCATCTCGACCACGACTCAACTCC[C/T]AACAGTCTATGGAGTATCTGACGGAGGAGGAATGTGCTCAGGTCCAGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: A genome-wide association study implicates diacylglycerol kinase eta (DGKH) and several other genes in the etiology of bipolar disorder. (View Study)
  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Nephrolithiasis: A genome-wide association study of nephrolithiasis in the Japanese population identifies novel susceptible Loci at 5q35.3, 7p14.3, and 13q14.1. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link