ENSDARG00000074174

Ensembl ID:
ENSDARG00000074174
Mouse Orthologues:
Gm10891, Gm10893, Gm10909, Gm13896, Gm13926, Gm13979, Gm16591, Gm16837, Gm16940, Gm17015, Gm6037, Gm6683
Mouse Descriptions:
predicted gene 10891 Gene [Source:MGI Symbol;Acc:MGI:3800299]
predicted gene 10893 Gene [Source:MGI Symbol;Acc:MGI:3704436]
predicted gene 10909 Gene [Source:MGI Symbol;Acc:MGI:3642826]
predicted gene 13896 Gene [Source:MGI Symbol;Acc:MGI:3702130]
predicted gene 13926 Gene [Source:MGI Symbol;Acc:MGI:3702147]
predicted gene 13979 Gene [Source:MGI Symbol;Acc:MGI:3651288]
predicted gene 17015 Gene [Source:MGI Symbol;Acc:MGI:4819748]
predicted gene 6037 Gene [Source:MGI Symbol;Acc:MGI:3649172]
predicted gene 6683 Gene [Source:MGI Symbol;Acc:MGI:3704133]
predicted gene, 16591 Gene [Source:MGI Symbol;Acc:MGI:4439369]
predicted gene, 16837 Gene [Source:MGI Symbol;Acc:MGI:4439761]
predicted gene, 16940 Gene [Source:MGI Symbol;Acc:MGI:4439864]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25115 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113456 Nonsense 63 114 2 3
Genomic Location:
Chromosome 2 (position 36203853)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACCACTGATACAAATCCATATCTCTTCTGGTACAAACAGCTGCCAAAC[A/T]GATCACCAACATTCATTCTGAATAAACTCACTTATGGTGAAGGAACTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ou34qlnv