LOC100332911

Ensembl ID:
ENSDARG00000074169
Human Orthologue:
GPAM
Human Description:
glycerol-3-phosphate acyltransferase, mitochondrial [Source:HGNC Symbol;Acc:24865]
Mouse Orthologue:
Gpam
Mouse Description:
glycerol-3-phosphate acyltransferase, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:109162]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11844 Essential Splice Site Available for shipment Available now
sa22137 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11844
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112061 Essential Splice Site 436 826 11 20
Genomic Location:
Chromosome 12 (position 33207779)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTCTYTGACGCTGGAGCAGATTCTTCTCCCCATCATCATCGCTACACA[G/T]TATGGCCTTTASACTGCCAGCAACCAACAATTATGTGGAYTGCTGTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112061 Nonsense 794 826 20 20
Genomic Location:
Chromosome 12 (position 33218944)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACACAAGAATAATGCACATCTCTCTCTGTACAGGTGCTAAAAGAACGA[C/T]GAGAAGATGGTGTGTGTCGTCTGGAGCTGAGCAGCACCTTCATACCTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ou98q03y