LOC100332911

Ensembl ID:
ENSDARG00000074169
Human Orthologue:
GPAM
Human Description:
glycerol-3-phosphate acyltransferase, mitochondrial [Source:HGNC Symbol;Acc:24865]
Mouse Orthologue:
Gpam
Mouse Description:
glycerol-3-phosphate acyltransferase, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:109162]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27984 Nonsense Mutation detected in F1 DNA During 2015
sa11844 Essential Splice Site Available for shipment Available now
sa22137 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa27984
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112061 Nonsense 416 826 11 20
Genomic Location:
Chromosome 12 (position 33207717)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCACGTGGTCTCCAATGCTTTAGGAATACCTGGATACTCAGCGCAGT[C/T]GACATCTCCAGGCCTCTCTGACGCTGGAGCAGATTCTTCTCCCCATCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11844
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112061 Essential Splice Site 436 826 11 20
Genomic Location:
Chromosome 12 (position 33207779)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTCTYTGACGCTGGAGCAGATTCTTCTCCCCATCATCATCGCTACACA[G/T]TATGGCCTTTASACTGCCAGCAACCAACAATTATGTGGAYTGCTGTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112061 Nonsense 794 826 20 20
Genomic Location:
Chromosome 12 (position 33218944)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACACAAGAATAATGCACATCTCTCTCTGTACAGGTGCTAAAAGAACGA[C/T]GAGAAGATGGTGTGTGTCGTCTGGAGCTGAGCAGCACCTTCATACCTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ou98q03y