si:ch211-204d2.5

Ensembl ID:
ENSDARG00000074168
ZFIN ID:
ZDB-GENE-041111-225
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A9C3U2]
Human Orthologue:
C10orf18
Human Description:
chromosome 10 open reading frame 18 [Source:HGNC Symbol;Acc:23484]
Mouse Orthologue:
BC016423
Mouse Description:
cDNA sequence BC016423 Gene [Source:MGI Symbol;Acc:MGI:2145274]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41133 Nonsense Mutation detected in F1 DNA During 2017
sa38672 Nonsense Mutation detected in F1 DNA During 2017
sa21207 Nonsense Available for shipment Available now
sa16911 Nonsense Available for shipment Available now
sa41134 Nonsense Mutation detected in F1 DNA During 2017
sa9993 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111957 Nonsense 105 2967 4 24
ENSDART00000137039 Nonsense 105 175 4 6
ENSDART00000141560   None 104 None 2
ENSDART00000147817   None 1186 None 6

The following transcripts of ENSDARG00000074168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11507301)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11161823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTCCTCCACAGGCAAGGAAAGTTGGTGAAACAGGCTTGTTGGTTGGG[C/T]GAGCGAAATGCTCCACCCTTGGAGACTCCTTGAAAGGTAAGGAAAGCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111957 Nonsense 794 2967 15 24
ENSDART00000137039   None 175 None 6
ENSDART00000141560   None 104 None 2
ENSDART00000147817   None 1186 None 6

The following transcripts of ENSDARG00000074168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11516002)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11153122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAAGGCGTAAAAGATTGTGGAGTCCTGATGCCACTCTGAAACGTTCTT[T/G]AAGATCAAATACTGCAAAGAATGAAAATGAGTCTATAGCAGACCCTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21207
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111957 Nonsense 1512 2967 17 24
ENSDART00000137039   None 175 None 6
ENSDART00000141560   None 104 None 2
ENSDART00000147817   None 1186 None 6

The following transcripts of ENSDARG00000074168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11520423)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11148701
KASP Assay ID:
2260-0197.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCAACAAAGCATTCATCTGCTGGGACAAGTGGCTCCCCAAGTCAAGTT[G/T]AAGCCTTGATGGTAACTGTATTGTACAATTTTTGTTACACTGTTCACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16911
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111957 Nonsense 1548 2967 18 24
ENSDART00000137039   None 175 None 6
ENSDART00000141560   None 104 None 2
ENSDART00000147817   None 1186 None 6

The following transcripts of ENSDARG00000074168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11520657)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11148467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGACACGGACACTGATGAAGAAAATGATATCGCCACTGACCACTCCTA[T/G]TCTCAGATTATGGAAGGAAACAGTGCGTACACCCAGTTGTGTGATCAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111957 Nonsense 2126 2967 19 24
ENSDART00000137039   None 175 None 6
ENSDART00000141560   None 104 None 2
ENSDART00000147817 Nonsense 345 1186 1 6

The following transcripts of ENSDARG00000074168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11522563)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11146561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGCCAACAAGATGTATCTGAAGCCAGAAGGGAGGAGGATACACTTGTT[G/T]AGAAGATTGAGACACAATCCATTCAGCGTTTGTCTCCCAAAATTGGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9993
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111957 Nonsense 2188 2967 19 24
ENSDART00000137039   None 175 None 6
ENSDART00000141560   None 104 None 2
ENSDART00000147817 Nonsense 407 1186 1 6

The following transcripts of ENSDARG00000074168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11522751)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11146373
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGCATGTGCTCTACTCCTACTCAAGATGAAATTCCTGAAATATGTTA[T/A]CCAGAAGTAAACAAAGAGTTGAGGGTAGAAGATCTGGACAGAAAACTKTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link