birc6

Ensembl ID:
ENSDARG00000074166
ZFIN ID:
ZDB-GENE-091202-7
Human Orthologue:
BIRC6
Human Description:
baculoviral IAP repeat-containing 6 [Source:HGNC Symbol;Acc:13516]
Mouse Orthologue:
Birc6
Mouse Description:
baculoviral IAP repeat-containing 6 Gene [Source:MGI Symbol;Acc:MGI:1276108]

Alleles

There are 19 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23063 Essential Splice Site Available for shipment Available now
sa6471 Nonsense Mutation detected in F1 DNA During 2016
sa23064 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa42920 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23065 Nonsense Available for shipment Available now
sa10215 Essential Splice Site Available for shipment Available now
sa17388 Essential Splice Site Available for shipment Available now
sa23066 Nonsense Mutation detected in F1 DNA During 2016
sa36396 Nonsense Mutation detected in F1 DNA During 2016
sa23067 Nonsense Available for shipment Available now
sa36397 Nonsense Mutation detected in F1 DNA During 2016
sa2916 Nonsense F2 line generated During 2016
sa13763 Nonsense Available for shipment Available now
sa13557 Nonsense Available for shipment Available now
sa39160 Nonsense Mutation detected in F1 DNA During 2016
sa8438 Nonsense Mutation detected in F1 DNA During 2016
sa17275 Nonsense Available for shipment Available now
sa36398 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12006 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23063
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 142 4870 2 76
Genomic Location (Zv9):
Chromosome 17 (position 22425705)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22575854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTGTCCAAGCCAGAAGACATGGTCCAGCTGGAGCTGCCCGTCACTGAA[G/A]TAAGATACGTGGCATATTGTGCATATTGATTTATTGTGTATAGCATTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 491 4870 10 76
Genomic Location (Zv9):
Chromosome 17 (position 22448495)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22598644
KASP Assay ID:
554-5426.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGACGATGGAGGTGAGTTTGGGAGTCACAGCTCTCAGTGTTCTACAA[C/T]AGCCTGAGAAATTGCAGTGGGAGGTGGTGGCYAGTGTTCTTGAGGACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Splice Site, Nonsense 1358 4870 20 76
Genomic Location (Zv9):
Chromosome 17 (position 22456184)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22606333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCATTGCTCTTTTTCTAAGAGATGTTATGATCTGTTGTCTTTTAGTT[T/A]GAGAGAGGGGAAAGAGGGGCTTTTGACCAAAACCAGAAGACGTCTGACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 1635 4870 25 76
Genomic Location (Zv9):
Chromosome 17 (position 22457858)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22608007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAGTTCTCCAGGAGAAGCAGCAACAGCTTCTAAAACTCCAGCAACAG[G/A]TCACATTCTTGCTTAATTGTAATGTTGATTTGTTTTCCATCTAGTTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23065
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 1866 4870 29 76
Genomic Location (Zv9):
Chromosome 17 (position 22460646)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22610795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATATGGCAGCACTAATGCCCGGGCTAAAATCCCATTGGGTTTTTATTA[T/A]GGCCACACCTACATCCTGCCATGGGAAAGTGAATTGAAGCTGATGCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10215
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 2229 4870 34 76
Genomic Location (Zv9):
Chromosome 17 (position 22464941)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22615090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGKCTGTATTCAYGCAAGATCCGCAAACAGCTAGWCCATCACAAACAGG[T/C]ACACGTGTCTTGCACAAACCTTTTTATTGTGCTAGGGTTTTTCTATACCR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17388
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 2345 4870 36 76
Genomic Location (Zv9):
Chromosome 17 (position 22465543)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22615692
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAATGGACTTCACCTGCCACGCAGACCTGCTCCTGTTTGTTTGCAAGG[T/C]GCAAATTRTWTTATGCATYCCTAAGTCGAGGCTGAMATGMAGGGGTGACY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 2355 4870 37 76
Genomic Location (Zv9):
Chromosome 17 (position 22467302)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22617451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGAATGTACTCCAACTACCCAGGTCTTGGCCAGGATAGCAAATGCGACA[C/T]GACCCACGATCCACCTGTGTGAAGTAGTTTCCGAGCAGCAGCTGGAACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 2958 4870 47 76
Genomic Location (Zv9):
Chromosome 17 (position 22477066)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22627215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAGCAGGTGGAGCTACTGACAGCGTGTCGGATGAAGAAAAAGTGTGT[G/T]GAAGTAAAGAGTGTGGGGCGGCAGGCACAGCTCAGCATCAGGGACCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23067
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3279 4870 52 76
Genomic Location (Zv9):
Chromosome 17 (position 22480651)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22630800
KASP Assay ID:
2261-0983.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGTTCCAGCTGGTAAAGGCAGAGGTGGCGTCTGCTGTGTGTCTGAGGT[T/A]GCACCGGCCGCGGGACGCTAGCACTCTTGGCCTCTCGCAGATCAAACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3524 4870 56 76
Genomic Location (Zv9):
Chromosome 17 (position 22483359)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22633508
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGGCCACCTGAACTATTAATTCTCTTCAATGTCTTGCAGGTTGTTGTA[C/A]AACTGGTCCATGTCTTTGCCCTCTAACATGGTTTTAAAGAAGGCTGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2916
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3575 4870 56 76
ENSDART00000114100 Nonsense 3575 4870 56 76
Genomic Location (Zv9):
Chromosome 17 (position 22483510)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22633659
KASP Assay ID:
554-3056.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGTCCTGGATGGGTATCGTGGCGCCCTCGTCTGCCCAGACCAAYGCG[C/T]AGCGCCGGATGGCCATGACCGAMGACGGCAAGAAGCAGCATGACTTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13763
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3626 4870 56 76
ENSDART00000114100 Nonsense 3626 4870 56 76
Genomic Location (Zv9):
Chromosome 17 (position 22483663)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22633812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCCATCTCCCTCTCAGAGTGCCAGCTGGTGACCCTTGCAGCYGCATCY[C/T]AGTCTCCTGGTGCCATTCAGCAGCTGYTAGACTCCGGTCTGCCTTCCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3626 4870 56 76
ENSDART00000114100 Nonsense 3626 4870 56 76
Genomic Location (Zv9):
Chromosome 17 (position 22483663)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22633812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCCATCTCCCTCTCAGAGTGCCAGCTGGTGACCCTTGCAGCYGCATCY[C/T]AGTCTCCTGGTGCCATTCAGCAGCTGYTAGACTCCGGTCTGCCTTCCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39160
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3652 4870 56 76
Genomic Location (Zv9):
Chromosome 17 (position 22483743)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22633892
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCCGGTCTGCCTTCCTTGCTGGTGCGTAGCTTGGCTGACCTTTGCTG[C/A]AACCTGTTGGTCAGCGCGGATCTTCCTTTACCTTCAGGATTCTCCTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8438
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3900 4870 60 76
Genomic Location (Zv9):
Chromosome 17 (position 22489219)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22639368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTAACCCTTTAGATACACCKAGCATCACAGCAAAACTGATCAATGAA[C/T]ARAAGGAGGATAAAGAGAAGAAAAACCATGAGGAAAAGGAAAAGATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17275
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 4047 4870 63 76
Genomic Location (Zv9):
Chromosome 17 (position 22498986)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22649135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGATTGAATGATGCATTTCTGGGCTTCTTTCGTCCTGTAGATCACTGC[G/T]AGATGCTAAGCGGCTGTCCTGACGATGAACCGATGACCCCRGGTGACGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 4282 4870 65 76
Genomic Location (Zv9):
Chromosome 17 (position 22503508)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22653657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCCATCATGCTCCCAGAGTGCCCAGCGGCAGTGCCAACTCCAGTGAG[G/A]TCAGTGTTAACCCGCACGCTGTTTACCTGTCATTCAGCCCACAAAAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12006
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 4393 4870 67 76
Genomic Location (Zv9):
Chromosome 17 (position 22509489)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22659638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCCTGTCTAATCCCTGCCATGWCTTCATACTTGCGCAATGACTCAGG[T/C]AAGACACGTGTCACATGTGAAATGYATTCAGTGCTTGACTTCTTGCAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link