birc6

Ensembl ID:
ENSDARG00000074166
ZFIN ID:
ZDB-GENE-091202-7
Human Orthologue:
BIRC6
Human Description:
baculoviral IAP repeat-containing 6 [Source:HGNC Symbol;Acc:13516]
Mouse Orthologue:
Birc6
Mouse Description:
baculoviral IAP repeat-containing 6 Gene [Source:MGI Symbol;Acc:MGI:1276108]

Alleles

There are 16 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23063 Essential Splice Site Available for shipment Available now
sa6471 Nonsense Mutation detected in F1 DNA During 2014
sa23064 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa23065 Nonsense Mutation detected in F1 DNA During 2014
sa10215 Essential Splice Site Available for shipment Available now
sa17388 Essential Splice Site Available for shipment Available now
sa23066 Nonsense Mutation detected in F1 DNA During 2014
sa2942 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23067 Nonsense Mutation detected in F1 DNA During 2014
sa2916 Nonsense F2 line generated During 2014
sa13763 Nonsense Available for shipment Available now
sa13557 Nonsense Available for shipment Available now
sa8438 Nonsense Mutation detected in F1 DNA During 2014
sa17275 Nonsense Available for shipment Available now
sa12006 Essential Splice Site Available for shipment Available now
sa2947 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23063
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 142 4870 2 76
Genomic Location:
Chromosome 17 (position 22425705)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTGTCCAAGCCAGAAGACATGGTCCAGCTGGAGCTGCCCGTCACTGAA[G/A]TAAGATACGTGGCATATTGTGCATATTGATTTATTGTGTATAGCATTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 491 4870 10 76
Genomic Location:
Chromosome 17 (position 22448495)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGACGATGGAGGTGAGTTTGGGAGTCACAGCTCTCAGTGTTCTACAA[C/T]AGCCTGAGAAATTGCAGTGGGAGGTGGTGGCYAGTGTTCTTGAGGACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Splice Site, Nonsense 1358 4870 20 76
Genomic Location:
Chromosome 17 (position 22456184)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCATTGCTCTTTTTCTAAGAGATGTTATGATCTGTTGTCTTTTAGTT[T/A]GAGAGAGGGGAAAGAGGGGCTTTTGACCAAAACCAGAAGACGTCTGACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 1866 4870 29 76
Genomic Location:
Chromosome 17 (position 22460646)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATATGGCAGCACTAATGCCCGGGCTAAAATCCCATTGGGTTTTTATTA[T/A]GGCCACACCTACATCCTGCCATGGGAAAGTGAATTGAAGCTGATGCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10215
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 2229 4870 34 76
Genomic Location:
Chromosome 17 (position 22464941)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGKCTGTATTCAYGCAAGATCCGCAAACAGCTAGWCCATCACAAACAGG[T/C]ACACGTGTCTTGCACAAACCTTTTTATTGTGCTAGGGTTTTTCTATACCR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17388
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 2345 4870 36 76
Genomic Location:
Chromosome 17 (position 22465543)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAATGGACTTCACCTGCCACGCAGACCTGCTCCTGTTTGTTTGCAAGG[T/C]GCAAATTRTWTTATGCATYCCTAAGTCGAGGCTGAMATGMAGGGGTGACY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 2355 4870 37 76
Genomic Location:
Chromosome 17 (position 22467302)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGAATGTACTCCAACTACCCAGGTCTTGGCCAGGATAGCAAATGCGACA[C/T]GACCCACGATCCACCTGTGTGAAGTAGTTTCCGAGCAGCAGCTGGAACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 2696 4870 43 76
Genomic Location:
Chromosome 17 (position 22472029)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTTTCTCTTCAATGCCAGCAGAGTGCCCACAATCCCTCTTAACCAAGG[T/A]CWGACATTCACTGACTTTAANAAAAGTGATAATTTTTTAATTCATCNTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3279 4870 52 76
Genomic Location:
Chromosome 17 (position 22480651)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGTTCCAGCTGGTAAAGGCAGAGGTGGCGTCTGCTGTGTGTCTGAGGT[T/A]GCACCGGCCGCGGGACGCTAGCACTCTTGGCCTCTCGCAGATCAAACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2916
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3575 4870 56 76
ENSDART00000114100 Nonsense 3575 4870 56 76
Genomic Location:
Chromosome 17 (position 22483510)
KASP Assay ID:
554-3056.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGTCCTGGATGGGTATCGTGGCGCCCTCGTCTGCCCAGACCAAYGCG[C/T]AGCGCCGGATGGCCATGACCGAMGACGGCAAGAAGCAGCATGACTTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13763
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3626 4870 56 76
ENSDART00000114100 Nonsense 3626 4870 56 76
Genomic Location:
Chromosome 17 (position 22483663)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCCATCTCCCTCTCAGAGTGCCAGCTGGTGACCCTTGCAGCYGCATCY[C/T]AGTCTCCTGGTGCCATTCAGCAGCTGYTAGACTCCGGTCTGCCTTCCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3626 4870 56 76
ENSDART00000114100 Nonsense 3626 4870 56 76
Genomic Location:
Chromosome 17 (position 22483663)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCCATCTCCCTCTCAGAGTGCCAGCTGGTGACCCTTGCAGCYGCATCY[C/T]AGTCTCCTGGTGCCATTCAGCAGCTGYTAGACTCCGGTCTGCCTTCCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8438
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 3900 4870 60 76
Genomic Location:
Chromosome 17 (position 22489219)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTAACCCTTTAGATACACCKAGCATCACAGCAAAACTGATCAATGAA[C/T]ARAAGGAGGATAAAGAGAAGAAAAACCATGAGGAAAAGGAAAAGATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17275
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 4047 4870 63 76
Genomic Location:
Chromosome 17 (position 22498986)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGATTGAATGATGCATTTCTGGGCTTCTTTCGTCCTGTAGATCACTGC[G/T]AGATGCTAAGCGGCTGTCCTGACGATGAACCGATGACCCCRGGTGACGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12006
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Essential Splice Site 4393 4870 67 76
Genomic Location:
Chromosome 17 (position 22509489)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCCTGTCTAATCCCTGCCATGWCTTCATACTTGCGCAATGACTCAGG[T/C]AAGACACGTGTCACATGTGAAATGYATTCAGTGCTTGACTTCTTGCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114100 Nonsense 4644 4870 72 76
Genomic Location:
Chromosome 17 (position 22558449)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCCTGCGGACACACCATATGCCAATGGCTGTTTTGAATTTGATGTCTA[T/A]TTTCCTCAAGACTATCCCAACTCCCCTCCTCTGGTWAATCTGGAGACCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4gl3nmh9