TNRC6B (1 of 3)

Ensembl ID:
ENSDARG00000074161
Description:
trinucleotide repeat containing 6B [Source:HGNC Symbol;Acc:29190]
Human Orthologue:
TNRC6B
Human Description:
trinucleotide repeat containing 6B [Source:HGNC Symbol;Acc:29190]
Mouse Orthologue:
Tnrc6b
Mouse Description:
trinucleotide repeat containing 6b Gene [Source:MGI Symbol;Acc:MGI:2443730]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2628 Essential Splice Site F2 line generated During 2014
sa7358 Missense Mutation detected in F1 DNA During 2014
sa22079 Nonsense Mutation detected in F1 DNA During 2014
sa11065 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2628
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114402 Essential Splice Site 31 1736 2 27
Genomic Location:
Chromosome 12 (position 20379722)
KASP Assay ID:
554-2537.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTAAAATATATGTTTTCATCAAATTTGTATCTCCTTTTTTATTGTTTT[A/C]GGTTGCAGAGCAAAAAAATAAAGGTAACTATTTTATTTCCATCTTTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7358
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114402 Missense 306 1736 6 27
Genomic Location:
Chromosome 12 (position 20381036)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTCCAGGTGCCAATTTTACCCCTAATGCCAATCCCTCTGCTTGGCCAG[C/T]CCKAGTACAGGAAGGGGCTGGGACAGTTGCAACAGAGGGTGGCTCCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114402 Nonsense 789 1736 8 27
Genomic Location:
Chromosome 12 (position 20382849)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGCCCGGCACAGCAGCAGCAGCAACCACAATCACAGCCTCAGCAGTG[T/A]CAGTCAGTGGACACAGGGGCCATGCAAGGGGGCTGGGGAAGACCAGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11065
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114402 Nonsense 838 1736 9 27
Genomic Location:
Chromosome 12 (position 20383074)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATGGAAATTGATGATGGAACATCTGCTTGGGGTGACCCCAGCAACTA[C/A]AACTACAAAAGTGTCAACTTGTGGGATAAAAACAATGCCCCATCTGGCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study of northwestern Europeans involves the C-type natriuretic peptide signaling pathway in the etiology of human height variation. (View Study)
  • Prostate cancer: A meta-analysis of genome-wide association studies to identify prostate cancer susceptibility loci associated with aggressive and non-aggressive disease. (View Study)
  • Prostate cancer: Sequence variants at 22q13 are associated with prostate cancer risk. (View Study)
  • Prostate cancer (gene x gene interaction): A genome-wide search for loci interacting with known prostate cancer risk-associated genetic variants. (View Study)
  • Uterine fibroids: A genome-wide association study identifies three loci associated with susceptibility to uterine fibroids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fiizm0dk