LOC100148532

Ensembl ID:
ENSDARG00000074160
Human Orthologue:
PAQR4
Human Description:
progestin and adipoQ receptor family member IV [Source:HGNC Symbol;Acc:26386]
Mouse Orthologue:
Paqr4
Mouse Description:
progestin and adipoQ receptor family member IV Gene [Source:MGI Symbol;Acc:MGI:1923748]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19031 Nonsense Mutation detected in F1 DNA During 2014
sa9849 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19031
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112565 Nonsense 262 272 3 3
ENSDART00000112565 Nonsense 262 272 3 3
Genomic Location:
Chromosome 12 (position 14282871)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCGTTCTGTCTATACTTTACTTACACTGGGGCATGCTGGAGGATTTA[C/T]GATGGTTAAAGGGATATCACTGTCCTGATGAATATGGCATTTATGATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9849
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112565 Nonsense 262 272 3 3
ENSDART00000112565 Nonsense 262 272 3 3
Genomic Location:
Chromosome 12 (position 14282871)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTSGTTCTGTCTAWACTKTACTTACACTGGGGCATGCTGGAGGATTTA[C/T]GATGGTTAAAGGGRTATCACTGTCCTGATGAATATGGYATTTATGATATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gkhahfnt