si:dkey-210m15.4

Ensembl ID:
ENSDARG00000074158
ZFIN ID:
ZDB-GENE-090313-233
Description:
Novel protein similar to vertebrate kinesin family member 16B (KIF16B) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
KIF16B
Human Description:
kinesin family member 16B [Source:HGNC Symbol;Acc:15869]
Mouse Orthologue:
Kif16b
Mouse Description:
kinesin family member 16B Gene [Source:MGI Symbol;Acc:MGI:1098240]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19595 Essential Splice Site Available for shipment Available now
sa25671 Nonsense Mutation detected in F1 DNA During 2017
sa19594 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109333 Essential Splice Site 90 1318 4 30
ENSDART00000131674   None 152 None 4
ENSDART00000140079   None 491 None 11
Genomic Location (Zv9):
Chromosome 1 (position 51776244)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50622511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTTCGCGAGCTGAATATTGGCTCTGAGTCATGACTTGCTACTTTATA[G/T]GGAGACCTCGGACTGATCCCACGCATCTGTGAAGGATTATTCAGCCGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25671
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109333 Nonsense 143 1318 5 30
ENSDART00000131674   None 152 None 4
ENSDART00000140079   None 491 None 11
Genomic Location (Zv9):
Chromosome 1 (position 51774892)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50621159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAACGAGCGCGTGCGGGATTTGTTACGGAGAAAGATGGCAAAAACTTA[T/A]AACCTCAGAGTCAGAGAGCACCCTAAAGAGGGACCCTATGTAGAAGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19594
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109333 Nonsense 557 1318 16 30
ENSDART00000131674   None 152 None 4
ENSDART00000140079 Nonsense 192 491 7 11
Genomic Location (Zv9):
Chromosome 1 (position 51765846)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50612343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTTCTCACCAGCCTGAGCTTATCCATGTCTGATCTGTCTAAATCCTGT[G/T]AAAACCTCTCCACCGTCATGCTCTATAACCCTGGGTAAGCCGCTGTGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ileal carcinoids: A pilot genome-wide association study shows genomic variants enriched in the non-tumor cells of patients with well-differentiated neuroendocrine tumors of the ileum. (View Study)
  • Intelligence: Genome-wide association study of intelligence: additive effects of novel brain expressed genes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link