LOC100333724

Ensembl ID:
ENSDARG00000074149
Human Orthologue:
ITPR1
Human Description:
inositol 1,4,5-triphosphate receptor, type 1 [Source:HGNC Symbol;Acc:6180]
Mouse Orthologue:
Itpr1
Mouse Description:
inositol 1,4,5-triphosphate receptor 1 Gene [Source:MGI Symbol;Acc:MGI:96623]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10895 Nonsense Available for shipment Available now
sa4430 Nonsense Mutation detected in F1 DNA During 2014
sa21954 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4429 Nonsense Mutation detected in F1 DNA During 2014
sa21953 Nonsense Available for shipment Available now
sa12719 Nonsense Available for shipment Available now
sa21952 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10895
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031993 Nonsense 235 2782 7 61
Genomic Location:
Chromosome 11 (position 36810974)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAGATTGTTTTATTTAWGAAGTGGAGCGACAACAAGGAGGCYATTCTT[A/T]AAGGGGTAGATGACCTATGAAATGTCATTTTTTTNYAAGATATGATGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4430
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031993 Nonsense 247 2782 8 61
Genomic Location:
Chromosome 11 (position 36810862)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCTCTGTGGTTGTTTAGGGGGACGTTGTTCGGCTGTTTCACGCGGAG[C/T]AGGAGAAGTTTCTGACCTGCGATGAGCACCGGAAGAAGCAGCACGTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031993 Essential Splice Site 1188 2782 28 61
Genomic Location:
Chromosome 11 (position 36771129)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAAGACGGACGGAAATGGCAGTGACAATTACAGAGACGTAAAAGAGG[T/A]AAAGTGTCTTTCACACGCACGCACATTTAGCTTTGTGTAGCAGTCAGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031993 Nonsense 1310 2782 31 61
Genomic Location:
Chromosome 11 (position 36764548)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGCAGTGAGATGAACGAACGTGTCGTGCAGCACTTTGTTCACTGCATC[G/T]AGACCCATGGCCGACACGTCCAGTACCTGAAGTTCCTGCAGACCATCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21953
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031993 Nonsense 1468 2782 33 61
Genomic Location:
Chromosome 11 (position 36757565)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGCAATCACATGTGGAAGCTCTTTGAAAACTTTCTGGTCGACATATG[C/A]AGGGTAACGAAAGCTTATTCGGGGATTTTTAGCAACCCCAATTATTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12719
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031993 Nonsense 1883 2782 44 61
Genomic Location:
Chromosome 11 (position 36685802)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCAGAGAAGTTCTTYAAGGTGTTTTACGAGCGRATGAAACTCGCCCAG[C/T]AGGAGATCAAGGCCACAGTGACGGTGAACACCAGCGATCTAKSCAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031993 Essential Splice Site 2450 2782 54 61
Genomic Location:
Chromosome 11 (position 36655247)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATATGCAGCCTTGGGGTCTTCGTTCACGTCTTCTTCTATAGTTTACTT[G/T]TGAGTACAAACACAAGCGCTCATTCACTCCAGCTCATCTTTCACACATCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p2qeplzk