myo10l3

Ensembl ID:
ENSDARG00000074143
ZFIN ID:
ZDB-GENE-070912-237
Human Orthologue:
MYO10
Human Description:
myosin X [Source:HGNC Symbol;Acc:7593]
Mouse Orthologue:
Myo10
Mouse Description:
myosin X Gene [Source:MGI Symbol;Acc:MGI:107716]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17549 Nonsense Available for shipment Available now
sa17384 Nonsense Available for shipment Available now
sa7176 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21444 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7175 Nonsense Mutation detected in F1 DNA During 2014
sa7174 Nonsense Mutation detected in F1 DNA During 2014
sa2501 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa17549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 213 2023 5 40
ENSDART00000138360 None None 916 None 16
ENSDART00000146265 Nonsense 212 684 5 18
ENSDART00000088042 Nonsense 213 2023 5 40
ENSDART00000138360 None None 916 None 16
ENSDART00000146265 Nonsense 212 684 5 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 13028744)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATACWGTTGCWTTAAATCCTTTAACATTTSTCTCCAGAATCGAGTTGTG[C/T]GACAAAATCCAGGAGAAAGAAACTATCATATTTTCTATGCCTTRTTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17384
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 213 2023 5 40
ENSDART00000138360 None None 916 None 16
ENSDART00000146265 Nonsense 212 684 5 18
ENSDART00000088042 Nonsense 213 2023 5 40
ENSDART00000138360 None None 916 None 16
ENSDART00000146265 Nonsense 212 684 5 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 13028744)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATACWGTTGCWTTAAATCCTTTAACATTTSTCTCCAGAATCGAGTTGTG[C/T]GACAAAATCCAGGAGAAAGAAACTATCATATTTTCTATGCCTTRTTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Essential Splice Site 272 2023 6 40
ENSDART00000138360 None None 916 None 16
ENSDART00000146265 Essential Splice Site 271 684 6 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 13028444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTAAAAGACAGAAGCCTAGATGACAAACACCTCTATGATAGTGTAATG[G/A]TGAGTCAAGAAATTGCTTTATTATCTTTGTGTGAAAGCATTGTTCTCGYR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21444
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Essential Splice Site 685 2023 18 40
ENSDART00000138360 None None 916 None 16
ENSDART00000146265 None 684 684 18 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 12988022)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGAAGTACGACGTCACGAAGAAAGAGTGGCAGCTGGGGAAGACTAAG[G/A]TGTGGTTGCATGACCAGCACATGTTCACACACTGTTTTAAGTAGAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7175
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 1506 2023 33 40
ENSDART00000138360 Nonsense 397 916 9 16
ENSDART00000146265 None None 684 None 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 12948696)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGTACTGGAGGAACCCCATCCTGAGATAYACACAGCACCCGCTGCACT[C/A]GCCCCTGCTGCCCCTGCCATAMGGAGAAGTCAACATCAACYGTGAGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7174
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 1513 2023 33 40
ENSDART00000138360 Nonsense 404 916 9 16
ENSDART00000146265 None None 684 None 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 12948674)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGATAYACACAGCACCCGCTGCACTMGCCCCTGCTGCCCCTGCCATA[C/A]GGAGAAGTCAACATCAACYGTGAGCCTCCATTTTACCCTCATCTGCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2501
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 2010 2023 40 40
ENSDART00000138360 Nonsense 901 916 16 16
ENSDART00000146265 None None 684 None 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 12940655)
KASP Assay ID:
554-3013.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGATAACCAAAATAATGAAAGCCTACATCAACATGATTGTTAAGAAA[C/T]GATGCAGTGTCAGATCAGTGGCCAGCTTTGGGAGCAACTGGATCAGGTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eobdeh5p