myo10l3

Ensembl ID:
ENSDARG00000074143
ZFIN ID:
ZDB-GENE-070912-237
Human Orthologue:
MYO10
Human Description:
myosin X [Source:HGNC Symbol;Acc:7593]
Mouse Orthologue:
Myo10
Mouse Description:
myosin X Gene [Source:MGI Symbol;Acc:MGI:107716]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17384 Nonsense Available for shipment Available now
sa17549 Nonsense Available for shipment Available now
sa7176 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31704 Nonsense Mutation detected in F1 DNA During 2016
sa34571 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21444 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41370 Nonsense Mutation detected in F1 DNA During 2016
sa7175 Nonsense Mutation detected in F1 DNA During 2016
sa7174 Nonsense Mutation detected in F1 DNA During 2016
sa2501 Nonsense F2 line generated During 2016
sa41369 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17384
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 213 2023 5 40
ENSDART00000138360   None 916 None 16
ENSDART00000146265 Nonsense 212 684 5 18
ENSDART00000088042 Nonsense 213 2023 5 40
ENSDART00000138360   None 916 None 16
ENSDART00000146265 Nonsense 212 684 5 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13028744)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12781309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATACWGTTGCWTTAAATCCTTTAACATTTSTCTCCAGAATCGAGTTGTG[C/T]GACAAAATCCAGGAGAAAGAAACTATCATATTTTCTATGCCTTRTTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 213 2023 5 40
ENSDART00000138360   None 916 None 16
ENSDART00000146265 Nonsense 212 684 5 18
ENSDART00000088042 Nonsense 213 2023 5 40
ENSDART00000138360   None 916 None 16
ENSDART00000146265 Nonsense 212 684 5 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13028744)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12781309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATACWGTTGCWTTAAATCCTTTAACATTTSTCTCCAGAATCGAGTTGTG[C/T]GACAAAATCCAGGAGAAAGAAACTATCATATTTTCTATGCCTTRTTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Essential Splice Site 272 2023 6 40
ENSDART00000138360   None 916 None 16
ENSDART00000146265 Essential Splice Site 271 684 6 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13028444)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12781009
KASP Assay ID:
554-5240.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTAAAAGACAGAAGCCTAGATGACAAACACCTCTATGATAGTGTAATG[G/A]TGAGTCAAGAAATTGCTTTATTATCTTTGTGTGAAAGCATTGTTCTCGYR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31704
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 436 2023 10 40
ENSDART00000138360   None 916 None 16
ENSDART00000146265 Nonsense 435 684 10 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13019594)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12772159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAGGAGTACTTCAACAAGCACATCTTCTCCCTGGAGCAGCTTGAATA[T/A]AACAGGTGAGTCCTGTCAATGGCCCTGGTTAGCACAGATCCAGATATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34571
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Essential Splice Site 647 2023 None 40
ENSDART00000138360   None 916 None 16
ENSDART00000146265 Essential Splice Site 646 684 None 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 12988139)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12740704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGTGGAGAGTGTATGTGAGTGTTTTCAAGCTGTACCCACTTCCTGTGC[A/T]GATACACTATGATCCTGAGGGACAGAAACCACACGGCGGACGAGAGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21444
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Essential Splice Site 685 2023 18 40
ENSDART00000138360   None 916 None 16
ENSDART00000146265   684 684 18 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 12988022)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12740587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGAAGTACGACGTCACGAAGAAAGAGTGGCAGCTGGGGAAGACTAAG[G/A]TGTGGTTGCATGACCAGCACATGTTCACACACTGTTTTAAGTAGAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 1489 2023 33 40
ENSDART00000138360 Nonsense 380 916 9 16
ENSDART00000146265   None 684 None 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 12948748)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12701313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTGGTGGTTGTGCAGGAGAGCAGTCTGAATGTGGAGGCTGTGGAG[C/T]AGATGTACTGGAGGAACCCCATCCTGAGATACACACAGCACCCGCTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7175
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 1506 2023 33 40
ENSDART00000138360 Nonsense 397 916 9 16
ENSDART00000146265   None 684 None 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 12948696)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12701261
KASP Assay ID:
554-4767.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGTACTGGAGGAACCCCATCCTGAGATAYACACAGCACCCGCTGCACT[C/A]GCCCCTGCTGCCCCTGCCATAMGGAGAAGTCAACATCAACYGTGAGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7174
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 1513 2023 33 40
ENSDART00000138360 Nonsense 404 916 9 16
ENSDART00000146265   None 684 None 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 12948674)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12701239
KASP Assay ID:
554-5121.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGATAYACACAGCACCCGCTGCACTMGCCCCTGCTGCCCCTGCCATA[C/A]GGAGAAGTCAACATCAACYGTGAGCCTCCATTTTACCCTCATCTGCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2501
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 2010 2023 40 40
ENSDART00000138360 Nonsense 901 916 16 16
ENSDART00000146265   None 684 None 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 12940655)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12693220
KASP Assay ID:
554-3013.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGATAACCAAAATAATGAAAGCCTACATCAACATGATTGTTAAGAAA[C/T]GATGCAGTGTCAGATCAGTGGCCAGCTTTGGGAGCAACTGGATCAGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088042 Nonsense 2011 2023 40 40
ENSDART00000138360 Nonsense 902 916 16 16
ENSDART00000146265   None 684 None 18

The following transcripts of ENSDARG00000074143 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 12940650)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12693215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACCAAAATAATGAAAGCCTACATCAACATGATTGTTAAGAAACGATG[C/A]AGTGTCAGATCAGTGGCCAGCTTTGGGAGCAACTGGATCAGGTGATGAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link