PARP14

Ensembl ID:
ENSDARG00000074139
Description:
poly (ADP-ribose) polymerase family, member 14 [Source:HGNC Symbol;Acc:29232]
Human Orthologues:
PARP14, PARP15
Human Descriptions:
poly (ADP-ribose) polymerase family, member 14 [Source:HGNC Symbol;Acc:29232]
poly (ADP-ribose) polymerase family, member 15 [Source:HGNC Symbol;Acc:26876]
Mouse Orthologues:
Parp14, Zc3hav1
Mouse Descriptions:
poly (ADP-ribose) polymerase family, member 14 Gene [Source:MGI Symbol;Acc:MGI:1919489]
zinc finger CCCH type, antiviral 1 Gene [Source:MGI Symbol;Acc:MGI:1926031]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34897 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41647 Nonsense Mutation detected in F1 DNA During 2017
sa6170 Nonsense Mutation detected in F1 DNA During 2017
sa34896 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112054 Essential Splice Site 263 1807 5 18
Genomic Location (Zv9):
Chromosome 10 (position 22150918)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21981346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAATTCCATCAGAGCATGCAGCCATTATTACATTTAAGGATGAAGAAGG[T/A]AAGTACATGCGCAATTGCTTGTAGTATTTTCTTGTTTGGCTCCATTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41647
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112054 Nonsense 987 1807 6 18
Genomic Location (Zv9):
Chromosome 10 (position 22147812)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21978240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTATAACCCCAAAATGGCTTTCCCACATCAAAGCAAACCTCATGAGTA[T/G]AGTAACTATGAGCATGGACATCGTGGAGGTGGTCGTGGTCGTGGTCATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112054 Nonsense 1315 1807 13 18
Genomic Location (Zv9):
Chromosome 10 (position 22144738)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21975166
KASP Assay ID:
554-5379.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCAATGGTCTATCTACARTWAAAGAGGTTGTTTTGTCTGTTCTGAAGT[T/A]GTGTGAATCACAKCAGTTTACCTCCATTGCCTTCCCTGCTCTTGGCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112054 Nonsense 1487 1807 15 18
Genomic Location (Zv9):
Chromosome 10 (position 22144010)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21974438
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAAATGCTGAACGCCATGCAGAAGGAGCTCACAGTCAGTATCAAACTA[G/T]AGAGGAAAGGCCAAGACTCTGTCGTTACTATGGAGGGTCTGACAAGAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link