si:ch211-152b13.4

Ensembl ID:
ENSDARG00000074137
ZFIN ID:
ZDB-GENE-060503-104
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0R0L6]
Human Orthologue:
C2CD3
Human Description:
C2 calcium-dependent domain containing 3 [Source:HGNC Symbol;Acc:24564]
Mouse Orthologue:
C2cd3
Mouse Description:
C2 calcium-dependent domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2142166]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11196 Nonsense Available for shipment Available now
sa35824 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35825 Nonsense Mutation detected in F1 DNA During 2017
sa28416 Nonsense Mutation detected in F1 DNA During 2017
sa22599 Nonsense Available for shipment Available now
sa35826 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32023 Essential Splice Site Available for shipment Available now
sa42505 Nonsense Mutation detected in F1 DNA During 2017
sa1436 Nonsense Available for shipment Available now
sa13118 Nonsense Available for shipment Available now
sa35827 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11196
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112974 Nonsense 95 2194 2 35
Genomic Location (Zv9):
Chromosome 15 (position 14280313)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15325276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGACACGCTGAACAGAAGGGGCTCAAATCCACAGCTCGCTTTCCTGTT[C/T]GATGTGGACCAAAACAGCTGACTTCTTATTTAACAGGTCTGATTGTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112974 Essential Splice Site 222 2194 4 35
Genomic Location (Zv9):
Chromosome 15 (position 14282355)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15327318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGCGTGTGAAGGAGACAGATGCCAGCAGCTCTGGACACATGCCCAGG[T/C]TTGATCATTTGACTGCTGAATGAACAAAATCTAATTGAATCACTCAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112974 Nonsense 403 2194 9 35
Genomic Location (Zv9):
Chromosome 15 (position 14285283)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15330246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGTATAGCTGTAATATGTTTTCTTATTTTAGATGTCAGATGAATGTT[T/A]GGAGGAGGACCATCATAGAAAAGGCACAACAGAGAAGCCTGTGCACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112974 Nonsense 492 2194 11 35
Genomic Location (Zv9):
Chromosome 15 (position 14286564)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15331527
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTATTAAAACTAACCTAATGCACACTTGTCCTGTTTGTCTAGTTTTTA[T/A]ATTGTAGAGTACCTCTTTCCACTGCTCTCTGCTGGGTATGAGAGTGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112974 Nonsense 824 2194 16 35
Genomic Location (Zv9):
Chromosome 15 (position 14291284)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15336247
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGAGCTGCTCCTGCAGTCTCAGTATCCAGTGGTTGGAGTGGACAGTTA[T/A]ATGCCTGTGGTGGATGTATTTAGCGGCAGCACGCGAGGAAACCTCAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112974 Essential Splice Site 941 2194 17 35
ENSDART00000112974 Essential Splice Site 941 2194 17 35
Genomic Location (Zv9):
Chromosome 15 (position 14293061)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15338024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCAGAATGAGTCAAGAGAGGACATGGACACACATGCTGTCGAGAGCC[G/T]TAAGCTGGTTCCTTGCTCACTGTATATATATAACCTTTGATTGAGTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32023
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112974 Essential Splice Site 941 2194 17 35
ENSDART00000112974 Essential Splice Site 941 2194 17 35
Genomic Location (Zv9):
Chromosome 15 (position 14293061)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15338024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCAGAATGAGTCAAGAGAGGACATGGACACACATGCTGTCGAGAGCC[G/T]TAAGCTGGTTCCTTGCTCACTGTATATATATAACCTTTGATTGAGTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42505
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112974 Nonsense 1534 2194 26 35
Genomic Location (Zv9):
Chromosome 15 (position 14306743)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15351706
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTGCTGACCTGCAGTATCTTGTGTTTGCTGTTTTGCATGTCAGGTTG[T/A]CCTCTGGCTGAAAGAGGGGGAGGGTTGCCAAGTTGTTGTGTTTCTTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112974 Nonsense 1658 2194 28 35
Genomic Location (Zv9):
Chromosome 15 (position 14308606)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15353569
KASP Assay ID:
554-1363.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGTCTGTGTCTCCTCTGAGAGCAGTGCAAGAGCTGCGGGCACATAGA[C/T]AGATGGCACAGGACACTCATGCTCCAGACTCCAGTGTAAGACATTATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13118
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112974 Nonsense 1923 2194 32 35
Genomic Location (Zv9):
Chromosome 15 (position 14316986)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15361949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAGATGAAGAAAAAAACGATCACATCTCCAGTGATGATGATGAAGAT[A/T]AAGACCAGGATGAGCATGTAGACTTTGAGGAAACTTTAATTCAKCCYAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112974 Nonsense 2115 2194 33 35
Genomic Location (Zv9):
Chromosome 15 (position 14317778)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15362741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAAATTTCTTCCTGTCAACTCACCATCTGGAGGCGTCCATGAGGGCTT[T/A]GAGGATGGCGCCTGTTTTTCCAACAGCTGAGTCTGTGAGTAATCGAACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link