kif5ba

Ensembl ID:
ENSDARG00000074131
ZFIN ID:
ZDB-GENE-070629-2
Description:
Novel protein similar to vertebrate kinesin family member 5A (KIF5A) [Source:UniProtKB/TrEMBL;Acc:B0
Human Orthologue:
KIF5B
Human Description:
kinesin family member 5B [Source:HGNC Symbol;Acc:6324]
Mouse Orthologue:
Kif5b
Mouse Description:
kinesin family member 5B Gene [Source:MGI Symbol;Acc:MGI:1098268]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25891 Nonsense Mutation detected in F1 DNA During 2017
sa31295 Essential Splice Site Available for shipment Available now
sa1774 Nonsense Confirmed mutation in F2 line During 2017
sa39921 Nonsense Mutation detected in F1 DNA During 2017
sa19854 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113849 Nonsense 46 968 2 26
ENSDART00000138947 Nonsense 46 850 2 23
Genomic Location (Zv9):
Chromosome 2 (position 43790921)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43876422
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTGAATGTACCATTGAACCGTGTTTTGTTTTTCTCAGGGTAAGCCGTA[T/A]GTGTTTGACAGAGTTTTCCAGTCCAACACGACACAGGAGCAGGTGTACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31295
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113849 Essential Splice Site 131 968 4 26
ENSDART00000138947 Essential Splice Site 131 850 4 23
Genomic Location (Zv9):
Chromosome 2 (position 43789698)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43875199
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTAACTACATTTACTCTATGGATGAAAACCTGGAGTTTCACATTAAAG[T/A]GAGTCTGAGTCTTATTCACTCTTTCTTCCTATTCATGGATGGTTTGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1774
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113849 Nonsense 138 968 5 26
ENSDART00000138947 Nonsense 138 850 5 23
Genomic Location (Zv9):
Chromosome 2 (position 43789559)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43875060
KASP Assay ID:
554-1767.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATATTGAGGGTGTGTTTTACCTTGGCAGGTGTCATATTTTGAAATTTA[T/A]CTGGATAAGATTCGGGATTTGTTGGATGGTGAGTGTGGTCGATGTTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113849 Nonsense 673 968 17 26
ENSDART00000138947 Nonsense 673 850 17 23
Genomic Location (Zv9):
Chromosome 2 (position 43775775)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43861276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTAGAGCAGAAGAAGAGACAGCTGGAGGAGGATGTGGACTCTCTCAAT[G/T]AAGAGCTGGTCAAAATCAGCGCTCAGGGTATTTATACACTCAGATGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19854
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113849 Nonsense 965 968 25 26
ENSDART00000138947   None 850 None 23
Genomic Location (Zv9):
Chromosome 2 (position 43768802)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43854479
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCTACCAGAACAGCCAACCTATGCCTATCAGAGGAGGTGGCACTAAA[C/T]AAGAGAAGAGGTTTGTGCTGTTTTCTTCTTCTTTGAGTCTGCTTATTAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link