EDEM3

Ensembl ID:
ENSDARG00000074129
Description:
ER degradation enhancer, mannosidase alpha-like 3 [Source:HGNC Symbol;Acc:16787]
Human Orthologue:
EDEM3
Human Description:
ER degradation enhancer, mannosidase alpha-like 3 [Source:HGNC Symbol;Acc:16787]
Mouse Orthologue:
Edem3
Mouse Description:
ER degradation enhancer, mannosidase alpha-like 3 Gene [Source:MGI Symbol;Acc:MGI:1914217]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12132 Nonsense Available for shipment Available now
sa21258 Nonsense Available for shipment Available now
sa10752 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12132
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111710 Nonsense 235 889 8 21
Genomic Location:
Chromosome 8 (position 20020690)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGACAGAGGAACAGTAATCTAGTGGGAACAACCATCAACATCCACTCT[G/T]GAGAATGGGTCCGCAGGGGTGAGCCTGAAACGTACCTAACAACCCAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111710 Nonsense 332 889 11 21
Genomic Location:
Chromosome 8 (position 20019014)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTAAAGGGAGATATCCGGCCAGCCATAGAGACTCATGAAATGCTTTA[T/A]CAGGTTACCAAGAAACACAACTTTCTCCCTGAGGTACCTTTTTCTACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10752
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111710 Essential Splice Site 632 889 17 21
Genomic Location:
Chromosome 8 (position 20014365)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAGGCCCCGCRCAGTTTGGAATGGACCTTTCCAAAAGCAGCTCTGGAG[T/C]GAGAATGATTAACRSWGACCTTTTATGATAAAACTTTCTCACCGGCTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pgr33t9u