si:ch211-77o19.1

Ensembl ID:
ENSDARG00000074126
ZFIN ID:
ZDB-GENE-091116-42
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JLE4]
Human Orthologue:
TTC39A
Human Description:
tetratricopeptide repeat domain 39A [Source:HGNC Symbol;Acc:18657]
Mouse Orthologue:
Ttc39a
Mouse Description:
tetratricopeptide repeat domain 39A Gene [Source:MGI Symbol;Acc:MGI:2444350]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21234 Nonsense Available for shipment Available now
sa41160 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41159 Nonsense Mutation detected in F1 DNA During 2017
sa30638 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21234
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108659 Nonsense 127 635 5 19
ENSDART00000132681 Nonsense 163 222 6 9
ENSDART00000146469 Nonsense 127 598 5 20
Genomic Location (Zv9):
Chromosome 8 (position 17012249)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16457137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATATTTGCTGCAGGAAACACAATGAAGGAGGCACAGGCTGTGTGTCAA[C/T]GGTGGGTTATATTCCGTTTCTAATAATCTTTCTTTTTGCGTATATATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41160
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108659 Essential Splice Site 142 635 6 19
ENSDART00000132681 Essential Splice Site 178 222 7 9
ENSDART00000146469 Essential Splice Site 142 598 6 20
Genomic Location (Zv9):
Chromosome 8 (position 17006596)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16451484
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGATACCGCAAAAAGTCTTCATTCAACAGCAAAAACTTCACCGAAGG[T/G]TGGTGCCTGTTATATTCATATTTCTCTAAATGACTGGTTGCTATTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41159
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108659 Nonsense 540 635 17 19
ENSDART00000132681   None 222 None 9
ENSDART00000146469 Nonsense 503 598 18 20
Genomic Location (Zv9):
Chromosome 8 (position 16993523)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16438411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCACAGATGACCAGTGTGTGGTTAGTTTGCTGAAGGGCCTCTGTCTC[A/T]AACACTTGGGTTACAAGGAGGAAGCAGAACATTACTTCACCCTCGTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108659 Essential Splice Site 558 635 17 19
ENSDART00000132681   None 222 None 9
ENSDART00000146469 Essential Splice Site 521 598 18 20
Genomic Location (Zv9):
Chromosome 8 (position 16993466)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16438354
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTTACAAGGAGGAAGCAGAACATTACTTCACCCTCGTCCTCTGCAAG[T/G]CAGTCTTACGCTTTTGCTTCGCAACAAATCACACTGATATGAAAAGAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link