LOC100005174

Ensembl ID:
ENSDARG00000074121
Human Orthologue:
DNMBP
Human Description:
dynamin binding protein [Source:HGNC Symbol;Acc:30373]
Mouse Orthologue:
Dnmbp
Mouse Description:
dynamin binding protein Gene [Source:MGI Symbol;Acc:MGI:1917352]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22138 Nonsense Mutation detected in F1 DNA During 2014
sa22139 Nonsense Available for shipment Available now
sa13284 Nonsense Available for shipment Available now
sa17521 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113621 Nonsense 643 1673 3 16
Genomic Location:
Chromosome 12 (position 33352483)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGAGAATGACATAATCCGTGGCTCCTCTCACTCCTCGATAGAACGTT[T/A]ATTACCTTCCACTTCCTCGCCTTCTGGCTCTGCCTCCTCCTCTTTGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22139
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113621 Nonsense 661 1673 3 16
Genomic Location:
Chromosome 12 (position 33352536)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCTTCCACTTCCTCGCCTTCTGGCTCTGCCTCCTCCTCTTTGGAGAGA[C/T]GAAAAAATCTGCGTCCACCTCCTCCTCGACCTCGAGTCCTTAGGCCTCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13284
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113621 Nonsense 856 1673 4 16
Genomic Location:
Chromosome 12 (position 33376700)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTGAAGACCCCGAACWAAGGATGCTGGAGAAAAGGACGAAGGTCATC[G/T]AGGAGCTTCTGCAAACTGAACATGACTACATCAAAGACCTTCAGATGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113621 Nonsense 1318 1673 13 16
Genomic Location:
Chromosome 12 (position 33388251)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTTAGTTTCTTCCCTGAAAACCTTCCTACTACTGTACGCAAGACTTTM[G/T]AGAAGAAGACTCTGGAGAAACAGWACACCAAGAAGCCCCAAGCACCTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b6w7qrmd