FRMPD2

Ensembl ID:
ENSDARG00000074119
Description:
FERM and PDZ domain containing 2 [Source:HGNC Symbol;Acc:28572]
Human Orthologue:
FRMPD2
Human Description:
FERM and PDZ domain containing 2 [Source:HGNC Symbol;Acc:28572]
Mouse Orthologue:
Gm10194
Mouse Description:
predicted gene 10194 Gene [Source:MGI Symbol;Acc:MGI:3642863]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18532 Nonsense Available for shipment Available now
sa21994 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18532
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108480 Nonsense 531 921 13 22
Genomic Location:
Chromosome 12 (position 2814756)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTTGGAGAGCTTCTGCTGGGAGTCTGTGCCAAGTGCATCACTGTGTA[T/A]GAAGTTATTAATAACTGCCGCACCGCAAGCCTTACATTCCATTGGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108480 Essential Splice Site 791 921 19 22
Genomic Location:
Chromosome 12 (position 2824114)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAAAGCAGCTCCAATGACGTGGAGCTCATCATTTCACAGCCCAAAGG[T/C]ACACTAGAAAAAATATGTTGCTCACTTCAATTTTTTTGTTTTTTAATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1tsohswa