FRMPD2

Ensembl ID:
ENSDARG00000074119
Description:
FERM and PDZ domain containing 2 [Source:HGNC Symbol;Acc:28572]
Human Orthologue:
FRMPD2
Human Description:
FERM and PDZ domain containing 2 [Source:HGNC Symbol;Acc:28572]
Mouse Orthologue:
Gm10194
Mouse Description:
predicted gene 10194 Gene [Source:MGI Symbol;Acc:MGI:3642863]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27854 Essential Splice Site Mutation detected in F1 DNA During 2015
sa18532 Nonsense Available for shipment Available now
sa21994 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa27854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108480 Essential Splice Site 268 921 7 22
Genomic Location:
Chromosome 12 (position 2804336)
KASP Assay ID:
2260-4792.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATCAGCTGTTTGCCTCTTCTTTTAGCCTTAATGAACGGAAAATGAAG[G/A]TAAGTAACTGCATAGATCCTTTTCATAGATGCATCTCTGGTGAAAATCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18532
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108480 Nonsense 531 921 13 22
Genomic Location:
Chromosome 12 (position 2814756)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTTGGAGAGCTTCTGCTGGGAGTCTGTGCCAAGTGCATCACTGTGTA[T/A]GAAGTTATTAATAACTGCCGCACCGCAAGCCTTACATTCCATTGGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108480 Essential Splice Site 791 921 19 22
Genomic Location:
Chromosome 12 (position 2824114)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAAAGCAGCTCCAATGACGTGGAGCTCATCATTTCACAGCCCAAAGG[T/C]ACACTAGAAAAAATATGTTGCTCACTTCAATTTTTTTGTTTTTTAATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1tsohswa