ftr15

Ensembl ID:
ENSDARG00000074118
ZFIN ID:
ZDB-GENE-070912-394
Description:
FinTRIM family protein [Source:UniProtKB/TrEMBL;Acc:B5WXZ9]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa637 Nonsense F2 line generated During 2015
sa25886 Nonsense Mutation detected in F1 DNA During 2015
sa19851 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa637
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044446 Nonsense 134 275 2 5
ENSDART00000061170 Nonsense 199 476 2 6
ENSDART00000098281 Nonsense 134 432 2 7
ENSDART00000111305   None 182 None 2
ENSDART00000112439 Nonsense 134 455 2 7
ENSDART00000114713   None 94 None 2
Genomic Location:
Chromosome 2 (position 43251788)
KASP Assay ID:
554-0546.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGTAAATGTAATGTATTTACTGTATTCTATGATTTCTGCAGAGGCAGT[T/A]GGAGGAAACCCAGAGTAAACATAATCAGAGAATCCAGAGGAAACAGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044446 Nonsense 156 275 2 5
ENSDART00000061170 Nonsense 221 476 2 6
ENSDART00000098281 Nonsense 156 432 2 7
ENSDART00000111305   None 182 None 2
ENSDART00000112439 Nonsense 156 455 2 7
ENSDART00000114713   None 94 None 2
Genomic Location:
Chromosome 2 (position 43251723)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAACATAATCAGAGAATCCAGAGGAAACAGGAGGAGTGTGTGGAGCTG[A/T]GAGTGGCTATAGAGTCTCAGAAGGTGAGTTTTGAGCAGAAGATCAACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19851
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044446   None 275 None 5
ENSDART00000061170   None 476 None 6
ENSDART00000098281 Nonsense 415 432 6 7
ENSDART00000111305   None 182 None 2
ENSDART00000112439 Nonsense 415 455 6 7
ENSDART00000114713   None 94 None 2
Genomic Location:
Chromosome 2 (position 43246044)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGACGTAATGATCAGTCCTGGGGTTTGTCCTGCTCTAGATCAAGATG[T/A]TCATTCTGCCACAATAAAAAACAGACCAAACTGCCAGTAATGTCCAACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eoj2qic0