ftr15

Ensembl ID:
ENSDARG00000074118
ZFIN ID:
ZDB-GENE-070912-394
Description:
FinTRIM family protein [Source:UniProtKB/TrEMBL;Acc:B5WXZ9]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa637 Nonsense F2 line generated During 2014
sa19851 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa637
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044446 Nonsense 134 275 2 5
ENSDART00000061170 Nonsense 199 476 2 6
ENSDART00000098281 Nonsense 134 432 2 7
ENSDART00000111305 None None 182 None 2
ENSDART00000112439 Nonsense 134 455 2 7
ENSDART00000114713 None None 94 None 2
Genomic Location:
Chromosome 2 (position 43251788)
KASP Assay ID:
554-0546.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGTAAATGTAATGTATTTACTGTATTCTATGATTTCTGCAGAGGCAGT[T/A]GGAGGAAACCCAGAGTAAACATAATCAGAGAATCCAGAGGAAACAGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19851
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044446 None None 275 None 5
ENSDART00000061170 None None 476 None 6
ENSDART00000098281 Nonsense 415 432 6 7
ENSDART00000111305 None None 182 None 2
ENSDART00000112439 Nonsense 415 455 6 7
ENSDART00000114713 None None 94 None 2
Genomic Location:
Chromosome 2 (position 43246044)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGACGTAATGATCAGTCCTGGGGTTTGTCCTGCTCTAGATCAAGATG[T/A]TCATTCTGCCACAATAAAAAACAGACCAAACTGCCAGTAATGTCCAACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eoj2qic0