si:dkey-1h24.2

Ensembl ID:
ENSDARG00000074117
ZFIN ID:
ZDB-GENE-060503-482
Description:
hypothetical protein LOC100137117 [Source:RefSeq peptide;Acc:NP_001108186]
Human Orthologue:
CCKBR
Human Description:
cholecystokinin B receptor [Source:HGNC Symbol;Acc:1571]
Mouse Orthologue:
Cckbr
Mouse Description:
cholecystokinin B receptor Gene [Source:MGI Symbol;Acc:MGI:99479]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18699 Nonsense Mutation detected in F1 DNA During 2017
sa38269 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109224 Nonsense 46 444 1 5
Genomic Location (Zv9):
Chromosome 1 (position 28598300)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28849129
KASP Assay ID:
2259-0672.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTAAGCGTGGAAGTTAACGCCACCTGTAGCAATGCGTCAATAATTCAG[A/T]AATTCAAACCCACACGACCTAAAGGTGAGTACTAACCAGTGCATGCCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109224 Nonsense 134 444 2 5
Genomic Location (Zv9):
Chromosome 1 (position 28580733)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28831562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTAGAGGACTTCATATTTGGAGCTGCGATGTGCAAGACAGTTGCATA[T/A]TTCATGGGTAAGGAGGACTTATTTAAACTTATTTCAACTGGAAGGTTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link