ENSDARG00000074116

Ensembl ID:
ENSDARG00000074116
Human Orthologue:
AC092718.1
Mouse Orthologue:
Pkd1l2
Mouse Description:
polycystic kidney disease 1 like 2 Gene [Source:MGI Symbol;Acc:MGI:2664668]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44678 Nonsense Mutation detected in F1 DNA During 2017
sa41069 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44678
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114562 Nonsense 212 488 4 8
Genomic Location (Zv9):
Chromosome 7 (position 67045191)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATACTACCTTACACATCATATTCGACAGAGCTTCAGCACTGGCATTT[C/A]AGAGACTCTGAACCACAAAGATATTTTCATTTGGGCAAATTCTTCCTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114562 Nonsense 330 488 5 8
Genomic Location (Zv9):
Chromosome 7 (position 67043236)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64958220
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCAGGCCAAACTTCGGGCAAACCCTGTTTGGGGTGGTCTGGCCCTATA[T/G]AAAGGAGGAGGATTTGTGGTGGACCTAGGTCCAGATCAAAAGAATGCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link