bcdin3d

Ensembl ID:
ENSDARG00000074111
ZFIN ID:
ZDB-GENE-050208-327
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8E7D2]
Human Orthologue:
BCDIN3D
Human Description:
BCDIN3 domain containing [Source:HGNC Symbol;Acc:27050]
Mouse Orthologue:
Bcdin3d
Mouse Description:
BCDIN3 domain containing Gene [Source:MGI Symbol;Acc:MGI:1922534]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24065 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24065
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110039 Nonsense 230 247 3 3
ENSDART00000145014 Nonsense 203 220 2 2
Genomic Location (Zv9):
Chromosome 22 (position 5666369)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5712436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCACATGCTAGAGAGCACTTGGAGAAGCAGTGCAGCATGGAGCTGGTG[C/T]AGTGTTTCGGTAATACGTCGTGGGACAGAAGCCTTCTGCTCTTTAGAAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Waist circumference: NRXN3 is a novel locus for waist circumference: a genome-wide association study from the CHARGE Consortium. (View Study)
  • Weight: Genome-wide association yields new sequence variants at seven loci that associate with measures of obesity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link