tgm2b

Ensembl ID:
ENSDARG00000074094
ZFIN ID:
ZDB-GENE-030131-2576
Description:
protein-glutamine gamma-glutamyltransferase 2 [Source:RefSeq peptide;Acc:NP_997821]
Human Orthologue:
TGM2
Human Description:
transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) [Source:HGNC Symbol;
Mouse Orthologue:
Tgm2
Mouse Description:
transglutaminase 2, C polypeptide Gene [Source:MGI Symbol;Acc:MGI:98731]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3579 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3579
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114314 Nonsense 149 592 4 11
Genomic Location:
Chromosome 6 (position 1946471)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTACAGTTGATGTRGTSTACATGGACAATGAGGAGAAGCTGGCGGAGTA[T/A]GTTTTGGCTCAGGATGGCATCATCTTCAGGGGCGATGCCGGATACCCCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8ednin2a