PNPLA8 (2 of 2)

Ensembl ID:
ENSDARG00000074093
Description:
patatin-like phospholipase domain containing 8 [Source:HGNC Symbol;Acc:28900]
Human Orthologue:
PNPLA8
Human Description:
patatin-like phospholipase domain containing 8 [Source:HGNC Symbol;Acc:28900]
Mouse Orthologue:
Pnpla8
Mouse Description:
patatin-like phospholipase domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1914702]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37659 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111954 Essential Splice Site 438 581 12 15
Genomic Location (Zv9):
Chromosome 23 (position 18060300)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17963239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCCAGGATATTTCCAAGAATTCCCCCTCCACGGTGACATACACCAGG[T/G]CAGTAAATTTTGTTTTAGTCCATTTGTAAGACTTAAAGGATATTAGTATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Smoking behavior: Large-scale genome-wide association study of Asian population reveals genetic factors in FRMD4A and other loci influencing smoking initiation and nicotine dependence. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link