ENSDARG00000074087

Ensembl ID:
ENSDARG00000074087
Human Orthologue:
AC114947.1
Human Description:
Serine/threonine-protein kinase NIM1 [Source:UniProtKB/Swiss-Prot;Acc:Q8IY84]
Mouse Orthologues:
E130304F04Rik, E130304F04Rik
Mouse Descriptions:
RIKEN cDNA E130304F04 gene Gene [Source:MGI Symbol;Acc:MGI:2442399]
RIKEN cDNA E130304F04 gene Gene [Source:MGI Symbol;Acc:MGI:2442399]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9426 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114561 Essential Splice Site 97 438 1 3
Genomic Location:
Chromosome 8 (position 32241179)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCGGAAACTTCTCTCATGTCAAGCTGGGCATCCATGCACTGACCAAAG[G/A]TAAYTGTACACAWGCTTTGATTTTTCTCTGTAAGCTTCAGTACTGCCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oxdipn6d