LOC100151338

Ensembl ID:
ENSDARG00000074086
Human Orthologue:
TECPR1
Human Description:
tectonin beta-propeller repeat containing 1 [Source:HGNC Symbol;Acc:22214]
Mouse Orthologue:
Tecpr1
Mouse Description:
tectonin beta-propeller repeat containing 1 Gene [Source:MGI Symbol;Acc:MGI:1917631]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25268 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11755 Essential Splice Site Available for shipment Available now
sa18349 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25268
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109621 Essential Splice Site 784 1144 17 28
Genomic Location:
Chromosome 3 (position 61915298)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACGATCACACAGCCTGGGTCTACACTGGGGGGTCATCAGCTCAGGGTA[A/T]ACACACACACACACGTCTGGATAAAATGAAGTGTAATAAACGGGTTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11755
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109621 Essential Splice Site 850 1144 19 28
Genomic Location:
Chromosome 3 (position 61912672)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGAGCACTAAAGAAAACACCAGACCTCCGTCACCGCAGTGGACATGGG[T/C]ACAGTRGTAGTTTTACTKCACTTTAGACAMATACTGATATTGAGTAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18349
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109621 Nonsense 1063 1144 25 28
Genomic Location:
Chromosome 3 (position 61903804)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGCTCAGCATGGGAGCTCATCTCCAATAATGTGTGTAAGGTGTCTGTC[G/T]GACCGCTGGACCAGGTTTGAGASCTTTTAAATTACGCATGCTTATTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mddnic3j