rnf26

Ensembl ID:
ENSDARG00000074074
ZFIN ID:
ZDB-GENE-060727-1
Human Orthologue:
RNF26
Human Description:
ring finger protein 26 [Source:HGNC Symbol;Acc:14646]
Mouse Orthologues:
Gm9008, Rnf26
Mouse Descriptions:
predicted pseudogene 9008 Pseudogene [Source:MGI Symbol;Acc:MGI:3644000]
ring finger protein 26 Gene [Source:MGI Symbol;Acc:MGI:2388131]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16221 Nonsense Available for shipment Available now
sa12290 Nonsense Available for shipment Available now
sa18213 Nonsense Available for shipment Available now
sa2788 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16221
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113279 Nonsense 157 425 1 1
Genomic Location:
Chromosome 15 (position 22711259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATCAAYACCATMGTCAACCTGCTCCTCATAGGCACTCAGAACTTATA[C/A]TCGCTGTTGGTGAGCACTGTGGAAGCRGTGTCATGTCCTCTGCAGAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12290
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113279 Nonsense 219 425 1 1
Genomic Location:
Chromosome 15 (position 22711444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGATGGAGTTTTTGGGATCAGCGTGTCAYATTTTTGTGAGCATATTTT[T/A]GCTCAATTCCTAYGGGCTRCTTCTCACGTTGGTGATCATCACCGGTGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18213
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113279 Nonsense 263 425 1 1
Genomic Location:
Chromosome 15 (position 22711575)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTATCTCTGCGCATGATCACCTATGTTAACACTGTACCTATTTTACGC[C/T]GACTCCRAATGGYTCTACARCGACTCTAYGTGCTGGARAGGAATGTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2788
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113279 Nonsense 408 425 1 1
Genomic Location:
Chromosome 15 (position 22712010)
KASP Assay ID:
554-2594.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGTGCAGAGAGTGCACCAACATTCTTCTGCGCCAGCCAATGTACCAA[C/T]AGAACTGCCCTCTGTGCCGCCACATGATCCTTCAGACCATGGATGTGTAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c5oife1s