LOC100334879

Ensembl ID:
ENSDARG00000074073
Human Orthologue:
MAP6
Human Description:
microtubule-associated protein 6 [Source:HGNC Symbol;Acc:6868]
Mouse Orthologue:
Mtap6
Mouse Description:
microtubule-associated protein 6 Gene [Source:MGI Symbol;Acc:MGI:1201690]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10345 Nonsense Available for shipment Available now
sa9296 Nonsense Mutation detected in F1 DNA During 2014
sa10982 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10345
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114267 Nonsense 115 381 1 3
ENSDART00000114267 Nonsense 115 381 1 3
Genomic Location:
Chromosome 15 (position 18877758)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCCTGGAGCKTCCGTCCAGAGCGCAGCTGCAAACCCAGAAACCAGTA[T/A]CAGCCATCAAAGACACCCTTCATCAACGAGACYCAGTATCAGAAAGATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114267 Nonsense 115 381 1 3
ENSDART00000114267 Nonsense 115 381 1 3
Genomic Location:
Chromosome 15 (position 18877758)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCCTGGAGCKTCCGTCCAGAGCGCAGCTGCAAACCCAGAAACCAGTA[T/A]CAGCCATCAAAGACACCCTTCATCAACGAGACYCAGTATCAGAAAGATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10982
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114267 Nonsense 261 381 2 3
Genomic Location:
Chromosome 15 (position 18881251)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAGGCTTACAGAGACATCAAGCCAGTGAAACCCATTAAAGCAAAATCT[C/T]AGTACAAACTCCTAGTGGGGGAAAAGACCAACCTGGAGACAAGTTATAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o876h2tu