tas2r200.2

Ensembl ID:
ENSDARG00000074066
ZFIN ID:
ZDB-GENE-050510-4
Description:
taste receptor, type 2, member 200.2 [Source:RefSeq peptide;Acc:NP_001018341]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21330 Nonsense Mutation detected in F1 DNA During 2014
sa13801 Nonsense Available for shipment Available now
hu3337 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
sa21330
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111533 Nonsense 5 331 1 1
Genomic Location:
Chromosome 8 (position 31629063)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCGTTTCTACATAAGACAACACGCATCTCGCCAGATGTCATATCAGTG[C/A]AGGACTCTGAAGAGAAAGATGAGCACCGACGTTGGCGACGTTCTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13801
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111533 Nonsense 129 331 1 1
Genomic Location:
Chromosome 8 (position 31629433)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTTGGCTGAGTCTCTTCTACTGCATCAAAGTTGTAAATTTCTCCTCT[G/T]AGATTTTCAGAACACTGAAGAAGAACATCTCRACTGTGATCAAYAYTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3337
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111533 Nonsense 278 331 1 1
Genomic Location:
Chromosome 8 (position 31629882)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTGTCTTTGTTCATCCTTATGAAGCTAATCGGGGCATATATCACATA[T/A]CAATACCTAGTCAGTACTTTTACCTTTTACTGTGGAGTGACTTCAGCACT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ydjew8n3