LOC100004261

Ensembl ID:
ENSDARG00000074060
Human Orthologue:
MAP3K14
Human Description:
mitogen-activated protein kinase kinase kinase 14 [Source:HGNC Symbol;Acc:6853]
Mouse Orthologue:
Map3k14
Mouse Description:
mitogen-activated protein kinase kinase kinase 14 Gene [Source:MGI Symbol;Acc:MGI:1858204]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26126 Essential Splice Site Mutation detected in F1 DNA During 2015
sa11635 Nonsense Available for shipment Available now
sa2107 Nonsense F2 line generated During 2015

Mutation Details

Allele Name:
sa26126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110791 Essential Splice Site 147 825 3 15
Genomic Location:
Chromosome 3 (position 37720973)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAGAGTGCCAGAACAGGACAGCGGAGAAGGGTCGTCTATCAATCAGG[T/C]ACGGCCTAATTACCTATAATTATAACAACTGATGAAAATTGTAAAAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11635
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110791 Nonsense 184 825 4 15
Genomic Location:
Chromosome 3 (position 37722543)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCCATCCAGGAAACCGAGGGTCCATCAGACTCTCATCAGTGGGAGTCA[C/T]AGCAGACCTCCTTTTTCTCCCCYAGCCAGAGTTATGCCGAAGAGAGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2107
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110791 Nonsense 361 825 7 15
Genomic Location:
Chromosome 3 (position 37726863)
KASP Assay ID:
554-2937.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTCTGYTTACACTCTCTTCAGGTTCTCTAGGACAGYTGGTGGAGGAA[C/T]GAGGCCGTCTGCCAGAGGATCTGTCCCTGCATTACCTTCAGCAAGTACTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/avb2avht