LOC100004261

Ensembl ID:
ENSDARG00000074060
Human Orthologue:
MAP3K14
Human Description:
mitogen-activated protein kinase kinase kinase 14 [Source:HGNC Symbol;Acc:6853]
Mouse Orthologue:
Map3k14
Mouse Description:
mitogen-activated protein kinase kinase kinase 14 Gene [Source:MGI Symbol;Acc:MGI:1858204]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11635 Nonsense Available for shipment Available now
sa2107 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa11635
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110791 Nonsense 184 825 4 15
Genomic Location:
Chromosome 3 (position 37722543)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCCATCCAGGAAACCGAGGGTCCATCAGACTCTCATCAGTGGGAGTCA[C/T]AGCAGACCTCCTTTTTCTCCCCYAGCCAGAGTTATGCCGAAGAGAGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2107
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110791 Nonsense 361 825 7 15
Genomic Location:
Chromosome 3 (position 37726863)
KASP Assay ID:
554-2937.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTCTGYTTACACTCTCTTCAGGTTCTCTAGGACAGYTGGTGGAGGAA[C/T]GAGGCCGTCTGCCAGAGGATCTGTCCCTGCATTACCTTCAGCAAGTACTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/avb2avht