dlg5

Ensembl ID:
ENSDARG00000074059
ZFIN ID:
ZDB-GENE-030131-3149
Description:
disks large homolog 5 [Source:RefSeq peptide;Acc:NP_001139075]
Human Orthologue:
DLG5
Human Description:
discs, large homolog 5 (Drosophila) [Source:HGNC Symbol;Acc:2904]
Mouse Orthologue:
Dlg5
Mouse Description:
discs, large homolog 5 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918478]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35447 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13331 Nonsense Available for shipment Available now
sa22258 Essential Splice Site Available for shipment Available now
sa15456 Essential Splice Site Available for shipment Available now
sa12813 Essential Splice Site Available for shipment Available now
sa13023 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105496 Essential Splice Site 1255 1926 18 32
ENSDART00000124710 Essential Splice Site 1287 1958 19 33
Genomic Location (Zv9):
Chromosome 13 (position 16497559)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16317594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCGGGCCTCACACGGCACCAACTCCCTGCCGTCCAGTGCAAGACTCGG[T/G]CAGTTTTCTTTAATAATACATGTTGTTGTCTGTTTACTCCACGCACCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13331
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105496 Nonsense 1410 1926 22 32
ENSDART00000124710 Nonsense 1442 1958 23 33
Genomic Location (Zv9):
Chromosome 13 (position 16512030)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16332065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACATCAGTATAATGGAATAAACCTGCGYAATGCCACTGAACAGCAAGCA[C/T]GACTCATCATTGGCCAGCAGTGTGACACCATCACGATCATGGCCCAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105496 Essential Splice Site 1606 1926 25 32
ENSDART00000124710 Essential Splice Site 1638 1958 26 33
Genomic Location (Zv9):
Chromosome 13 (position 16522524)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16342559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGTTCAACCAGGTGAAAGGCACTCCTGGAGATGGATTCTATATCAGG[T/C]ACAGTATGATATCGCATCTGCCATTGACTTACATAAGCACACATGGCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15456
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105496 Essential Splice Site 1856 1926 30 32
ENSDART00000124710 Essential Splice Site 1888 1958 31 33
ENSDART00000105496 Essential Splice Site 1856 1926 30 32
ENSDART00000124710 Essential Splice Site 1888 1958 31 33
Genomic Location (Zv9):
Chromosome 13 (position 16532164)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16352199
KASP Assay ID:
2260-6217.2 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTACCCAATCGTCATTTTCATACGCTACAAAAAYGCAAAGCAGATAAA[G/A]TAAGTTTTCACATCCTCCTYMACACATACATATCAAAATAATCATAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12813
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105496 Essential Splice Site 1856 1926 30 32
ENSDART00000124710 Essential Splice Site 1888 1958 31 33
ENSDART00000105496 Essential Splice Site 1856 1926 30 32
ENSDART00000124710 Essential Splice Site 1888 1958 31 33
Genomic Location (Zv9):
Chromosome 13 (position 16532164)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16352199
KASP Assay ID:
2260-6217.2 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTACCCAATCGTCATTTTCATACGCTACAAAAAYGCAAAGCAGATAAA[G/A]TAAGTTTTCACATCCTCCTYMACACATACMTATCAAAATAATCATAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13023
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105496 Essential Splice Site 1856 1926 30 32
ENSDART00000124710 Essential Splice Site 1888 1958 31 33
ENSDART00000105496 Essential Splice Site 1856 1926 30 32
ENSDART00000124710 Essential Splice Site 1888 1958 31 33
Genomic Location (Zv9):
Chromosome 13 (position 16532164)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 16352199
KASP Assay ID:
2260-6217.2 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTACCCAATCGTCATTTTCATACGCTACAAAAAYGCAAAGCAGATAAA[G/A]TAAGTTTTCACATCCTCCTYMACACATACMTATCAAAATAATCATAAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link