calm3a

Ensembl ID:
ENSDARG00000074057
ZFIN IDs:
ZDB-GENE-020415-2, ZDB-GENE-030131-527, ZDB-GENE-030131-5590, ZDB-GENE-030804-3
Description:
Calmodulin [Source:UniProtKB/Swiss-Prot;Acc:Q6PI52]
Human Orthologues:
CALM1, CALM2, CALM3
Human Descriptions:
calmodulin 1 (phosphorylase kinase, delta) [Source:HGNC Symbol;Acc:1442]
calmodulin 2 (phosphorylase kinase, delta) [Source:HGNC Symbol;Acc:1445]
calmodulin 3 (phosphorylase kinase, delta) [Source:HGNC Symbol;Acc:1449]
Mouse Orthologues:
Calm1, Calm2, Calm3
Mouse Descriptions:
calmodulin 1 Gene [Source:MGI Symbol;Acc:MGI:88251]
calmodulin 2 Gene [Source:MGI Symbol;Acc:MGI:103250]
calmodulin 3 Gene [Source:MGI Symbol;Acc:MGI:103249]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37327 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37327
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065392 Essential Splice Site 140 149 5 6
Genomic Location (Zv9):
Chromosome 21 (position 26123137)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26692955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGATCCGGGAGGCAGATATTGATGGTGACGGCCAGGTTAACTATGAAG[G/A]TATTTTCACGTTAATGTTGTTAATGTGCAAACACACATAAAATCTTATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link