si:ch211-281g13.5

Ensembl ID:
ENSDARG00000074052
ZFIN ID:
ZDB-GENE-090311-7
Description:
hypothetical protein LOC100148091 [Source:RefSeq peptide;Acc:NP_001139103]
Human Orthologues:
HERC5, HERC6
Human Descriptions:
hect domain and RLD 5 [Source:HGNC Symbol;Acc:24368]
hect domain and RLD 6 [Source:HGNC Symbol;Acc:26072]
Mouse Orthologue:
Herc6
Mouse Description:
hect domain and RLD 6 Gene [Source:MGI Symbol;Acc:MGI:1914388]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32762 Essential Splice Site Available for shipment Available now
sa25661 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32762
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113315 Essential Splice Site 324 992 7 24
Genomic Location (Zv9):
Chromosome 1 (position 50035387)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 48884568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGAACAGGTCAAGCAGTCTGTGCCGTTACCAGTGCTTCTGCCAACTGG[T/C]AATAGAAGTCATATTTTAGCAGTAGCTTTTATTTTCCTGAATGTTGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25661
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113315 Essential Splice Site 406 992 10 24
Genomic Location (Zv9):
Chromosome 1 (position 50034652)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 48883833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTGTTCTCCTCCGCTGCCTCACTGAATGGAAGTTTTCTCAAAACAAG[G/A]TAAAATTAGGTAGTCTTGTCTAGTAATCTAGACCTTTTTTAAATCAGTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link