abca5

Ensembl ID:
ENSDARG00000074041
ZFIN ID:
ZDB-GENE-050517-5
Description:
ATP-binding cassette sub-family A member 5 [Source:RefSeq peptide;Acc:NP_001092716]
Human Orthologues:
ABCA10, ABCA5, ABCA6, ABCA8, ABCA9
Human Descriptions:
ATP-binding cassette, sub-family A (ABC1), member 10 [Source:HGNC Symbol;Acc:30]
ATP-binding cassette, sub-family A (ABC1), member 5 [Source:HGNC Symbol;Acc:35]
ATP-binding cassette, sub-family A (ABC1), member 6 [Source:HGNC Symbol;Acc:36]
ATP-binding cassette, sub-family A (ABC1), member 8 [Source:HGNC Symbol;Acc:38]
ATP-binding cassette, sub-family A (ABC1), member 9 [Source:HGNC Symbol;Acc:39]
Mouse Orthologues:
Abca5, Abca6, Abca8a, Abca8b, Abca9
Mouse Descriptions:
ATP-binding cassette, sub-family A (ABC1), member 5 Gene [Source:MGI Symbol;Acc:MGI:2386607]
ATP-binding cassette, sub-family A (ABC1), member 6 Gene [Source:MGI Symbol;Acc:MGI:1923434]
ATP-binding cassette, sub-family A (ABC1), member 8a Gene [Source:MGI Symbol;Acc:MGI:2386846]
ATP-binding cassette, sub-family A (ABC1), member 8b Gene [Source:MGI Symbol;Acc:MGI:1351668]
ATP-binding cassette, sub-family A (ABC1), member 9 Gene [Source:MGI Symbol;Acc:MGI:2386796]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12201 Nonsense Available for shipment Available now
sa15733 Nonsense Available for shipment Available now
sa22162 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22163 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112302 Nonsense 2 1673 1 39
ENSDART00000127464 Nonsense 2 1673 1 40
Genomic Location:
Chromosome 12 (position 40351448)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAACAACAACGCRAATCTGGAGGACAGGAAAGACATGTCTTAATGTA[T/A]TTCATACGTAAGTGCGCTTCTTTGTTTARGCATGAGGGAAAGCTRTTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15733
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112302 Nonsense 694 1673 15 39
ENSDART00000127464 Nonsense 694 1673 15 40
Genomic Location:
Chromosome 12 (position 40378304)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACTGAAGAGCCGTAGAGCAGGCAGAGTTACWGTTCTCAGCACTCACTA[T/A]ATGGATGAGGCTGATATACTTGCAGGTGCTTCTCTCATTTTTCTCTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112302 Essential Splice Site 1031 1673 22 39
ENSDART00000127464 Essential Splice Site 1031 1673 22 40
Genomic Location:
Chromosome 12 (position 40387218)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATAATGGCACTGGACACATTAGAACATGGTCCAAACCCTTTGATTATG[T/G]AAGTGCAGTGCTCTAAAACATCAAAGTCAACACATTAATTTTGCGGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112302 Essential Splice Site 1608 1673 37 39
ENSDART00000127464 Essential Splice Site 1608 1673 37 40
Genomic Location:
Chromosome 12 (position 40394979)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGAAGATGTGAAGTCTTTAGCCAAGTCTTTTGCCCAGTTAGAAAGTG[G/A]TAAGAGATGGACACCATAACAATGAGAAGAATTTGAGAAGAATTGAAAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8oci57p9