
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-227i14.2
- Ensembl ID:
- ENSDARG00000074040
- ZFIN ID:
- ZDB-GENE-081104-186
- Description:
- Novel protein similar to vertebrate E1A binding protein p400 (EP400) [Source:UniProtKB/TrEMBL;Acc:B0
- Human Orthologues:
- EP400, EP400NL
- Human Descriptions:
- E1A binding protein p400 [Source:HGNC Symbol;Acc:11958]
- EP400 N-terminal like [Source:HGNC Symbol;Acc:26602]
- Mouse Orthologue:
- Ep400
- Mouse Description:
- E1A binding protein p400 Gene [Source:MGI Symbol;Acc:MGI:1276124]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38707 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa27259 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa21364 | Nonsense | Available for shipment | Available now |
sa21365 | Essential Splice Site | Available for shipment | Available now |
sa5775 | Nonsense | F2 line generated | During 2018 |
sa1673 | Essential Splice Site | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa38707
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111655 | Essential Splice Site | 415 | 3108 | 3 | 63 |
ENSDART00000138261 | None | 184 | None | 3 | |
ENSDART00000145142 | Essential Splice Site | 437 | 1616 | 2 | 24 |
The following transcripts of ENSDARG00000074040 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 46419676)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 43723813 GRCz11 8 43717232 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTATTTTCTGTGGCTTTGTATCTTTCATCTGTTTCTATGACAACCTCTC[A/G]GGTGAAAGTAGTGACTGGAAAGGATGGACAGACAGTGACTCCGGTTGCTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa27259
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111655 | Nonsense | 876 | 3108 | 12 | 63 |
ENSDART00000138261 | None | 184 | None | 3 | |
ENSDART00000145142 | Nonsense | 898 | 1616 | 9 | 24 |
The following transcripts of ENSDARG00000074040 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 46427789)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 43715700 GRCz11 8 43709119 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAAGCATCATTTTGAGATCTACGACAAACAAAAAAAAGTTCTCTGCTTG[C/T]AGAAGGCTTCGAGTAAAGGTGAGATTGAGAAATGAAAACTTTATGGCCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21364
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111655 | Nonsense | 1667 | 3108 | 29 | 63 |
ENSDART00000138261 | None | 184 | None | 3 | |
ENSDART00000145142 | None | 1616 | None | 24 |
The following transcripts of ENSDARG00000074040 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 46441714)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 43701775 GRCz11 8 43695194 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCACACCACCACAAGGTGAGGCACTGCTCCGTTCTGAAGCTGATTTTTA[T/G]CTTCATGTGGGTTGGCCAACAAGGTTTTTGAAAACTAGGCCCAGCAATAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21365
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111655 | Essential Splice Site | 2200 | 3108 | 39 | 63 |
ENSDART00000138261 | None | 184 | None | 3 | |
ENSDART00000145142 | None | 1616 | None | 24 |
The following transcripts of ENSDARG00000074040 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 46453268)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 43690627 GRCz11 8 43684046 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGACGAAGAGGATCTGCTCTCCTATACTAGAGAGGATGCATACAACATG[G/A]TACAAATATATTTTAGCTAGTTGTTGTGTAAAATATGATGTGGCATAGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5775
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111655 | Nonsense | 2509 | 3108 | 47 | 63 |
ENSDART00000138261 | None | 184 | None | 3 | |
ENSDART00000145142 | None | 1616 | None | 24 | |
ENSDART00000111655 | Nonsense | 2509 | 3108 | 47 | 63 |
ENSDART00000138261 | None | 184 | None | 3 | |
ENSDART00000145142 | None | 1616 | None | 24 |
The following transcripts of ENSDARG00000074040 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 46456757)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 43687138 GRCz11 8 43680557 - KASP Assay ID:
- 554-3480.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCAGGCACTAGCCGAACAGCAGAGGGCTCAGCAGTTAGCCCAACAGCAG[C/T]AGCAGACCACAGGMGCYGCTCAGCCTCAGGGAGCAGCAGCACAGCCYCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1673
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111655 | Essential Splice Site | 2573 | 3108 | 48 | 63 |
ENSDART00000138261 | None | 184 | None | 3 | |
ENSDART00000145142 | None | 1616 | None | 24 |
The following transcripts of ENSDARG00000074040 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 46457847)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 43686048 GRCz11 8 43679467 - KASP Assay ID:
- 554-1619.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGACTGGAGCCCTCAAGACTGCTGCAGCAGGCACAAGCATCCAGCCAGG[T/G]ATCATCACATTACACRTTTTTTCTGTACTTGTTTGTACTATTTATGTATT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: