si:ch211-194c3.6

Ensembl ID:
ENSDARG00000074036
ZFIN ID:
ZDB-GENE-090313-64
Description:
Novel protein similar to vertebrate kyphoscoliosis peptidase (KY) [Source:UniProtKB/TrEMBL;Acc:B8JIN
Human Orthologue:
KY
Human Description:
kyphoscoliosis peptidase [Source:HGNC Symbol;Acc:26576]
Mouse Orthologue:
Ky
Mouse Description:
kyphoscoliosis peptidase Gene [Source:MGI Symbol;Acc:MGI:96709]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31912 Nonsense Available for shipment Available now
sa42158 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111463 Nonsense 275 866 4 7
ENSDART00000131255 Nonsense 93 477 3 6
Genomic Location (Zv9):
Chromosome 13 (position 13611936)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13619931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTACGATATAGAGGGATACCTTGGTCTTTCTCAGAAGATTTGTTCTT[T/A]AGATGAAGTCATCAGGAATGGAAAAGGTGTATGTAGTGGTTACTCCAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111463 Essential Splice Site 425 866 6 7
ENSDART00000131255 Essential Splice Site 243 477 5 6
Genomic Location (Zv9):
Chromosome 13 (position 13608682)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13616677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTTGGGACTGACCCTCATACATCCCAAGCAGTATAAGACAATCACAG[G/A]TGTACATATGCACACAAAACATACACTATTAACGTAAATATGCTCATGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link