adamtsl2

Ensembl ID:
ENSDARG00000074033
ZFIN ID:
ZDB-GENE-070705-558
Human Orthologues:
AC002321.2, ADAMTSL2
Human Descriptions:
ADAMTS-like 2 [Source:HGNC Symbol;Acc:14631]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A8MZ67]
Mouse Orthologue:
Adamtsl2
Mouse Description:
ADAMTS-like 2 Gene [Source:MGI Symbol;Acc:MGI:1925044]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7575 Missense Mutation detected in F1 DNA During 2016
sa40592 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38524 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa7575
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108729 Missense 50 617 2 14
ENSDART00000138816   None 396 None 8
ENSDART00000148064 Missense 200 362 6 8
Genomic Location (Zv9):
Chromosome 5 (position 68904652)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65236874
KASP Assay ID:
554-4018.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTAACTAAGTGAATTGCTTCTTTGAAGGCTATACTTTCATAACTCAAA[T/G]CCCCGAAGGATCATGGGACATCCAGGTYATTGAGAGGAAGAAGTCTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40592
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108729 Essential Splice Site 128 617 3 14
ENSDART00000138816   None 396 None 8
ENSDART00000148064 Essential Splice Site 278 362 7 8
Genomic Location (Zv9):
Chromosome 5 (position 68902030)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65234252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGTACATCGTGGCGAAAGGGCCCATCGATCAGCCCATCAATGTTCTGG[T/C]ACTGTAGCTGTGGTCCTCCCTTCGCCGCCAAGGGCTCATGGGTAATCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38524
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108729 Essential Splice Site 183 617 5 14
ENSDART00000138816   None 396 None 8
ENSDART00000148064   None 362 None 8
Genomic Location (Zv9):
Chromosome 5 (position 68891179)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65223401
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAATGGAATGTGCTGCAGACTCGAGGCTTTGCTTTTTTTTTTTGTTAA[C/T]GTTCTCCGAGACATTCAAAGAGCACAGAGGAGAGACGGCCAAGCAGAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link