adamtsl2

Ensembl ID:
ENSDARG00000074033
ZFIN ID:
ZDB-GENE-070705-558
Human Orthologues:
AC002321.2, ADAMTSL2
Human Descriptions:
ADAMTS-like 2 [Source:HGNC Symbol;Acc:14631]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A8MZ67]
Mouse Orthologue:
Adamtsl2
Mouse Description:
ADAMTS-like 2 Gene [Source:MGI Symbol;Acc:MGI:1925044]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7575 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7575
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108729 Missense 50 617 2 14
ENSDART00000138816 None None 396 None 8
ENSDART00000148064 Missense 200 362 6 8
Genomic Location:
Chromosome 5 (position 68904652)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTAACTAAGTGAATTGCTTCTTTGAAGGCTATACTTTCATAACTCAAA[T/G]CCCCGAAGGATCATGGGACATCCAGGTYATTGAGAGGAAGAAGTCTGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9mj86thz