si:ch211-103i6.5

Ensembl ID:
ENSDARG00000074031
ZFIN ID:
ZDB-GENE-090313-7
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A452]
Human Orthologue:
FASTKD2
Human Description:
FAST kinase domains 2 [Source:HGNC Symbol;Acc:29160]
Mouse Orthologue:
Fastkd2
Mouse Description:
FAST kinase domains 2 Gene [Source:MGI Symbol;Acc:MGI:1922869]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39538 Nonsense Mutation detected in F1 DNA During 2017
sa11479 Nonsense Available for shipment Available now
sa16910 Nonsense Available for shipment Available now
sa13769 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39538
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108816 Nonsense 4 652 1 11
ENSDART00000145378 Nonsense 4 568 3 11
Genomic Location (Zv9):
Chromosome 1 (position 5089779)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 5528341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTCTGAAGCTTTAATGAATCCCTCTGTCAGGAAAACATGAATGTGTA[T/G]AAATCAGGCTTGGATATGCTCAGATTAGCTCTGAAATCCACATCACCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11479
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108816 Nonsense 96 652 1 11
ENSDART00000145378 Nonsense 96 568 3 11
Genomic Location (Zv9):
Chromosome 1 (position 5090053)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 5528615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTKTWGAAGTCTCTGATCAAGCGGMYAGCACTMCTTTCAGTGCTCRTTTA[C/T]AGAAATGTTCTTGCCCCACGGATGTGTTGGATGCAGTAAAGCAGTTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16910
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108816 Nonsense 137 652 1 11
ENSDART00000145378 Nonsense 137 568 3 11
Genomic Location (Zv9):
Chromosome 1 (position 5090176)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 5528738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCTTCTCACGCATGCGGGAGAGCACCAAGAAGAYGACKGCAGAGCAG[C/T]AGCGCTGTGAGCTCCAGCTSATGTTTGAACACCCGGGCTTTAGGGAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108816 Nonsense 588 652 10 11
ENSDART00000145378   None 568 None 11
Genomic Location (Zv9):
Chromosome 1 (position 5105146)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 5543608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGATCTGCGCTCAACCTAATTCCTTTTGCTTCGGTACGACKCATCCT[C/T]GAGCCAGCTTGGTTMTGAAACTTCGCCATCTTGAAAAACTKGGTTATCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • QT interval (interaction): Drug-gene interactions and the search for missing heritability: a cross-sectional pharmacogenomics study of the QT interval. (View Study)
  • Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link