si:dkey-202m22.5

Ensembl ID:
ENSDARG00000074030
ZFIN ID:
ZDB-GENE-030131-3885
Human Orthologue:
MYT1
Human Description:
myelin transcription factor 1 [Source:HGNC Symbol;Acc:7622]
Mouse Orthologue:
Myt1
Mouse Description:
myelin transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1100535]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24368 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24368
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114628 Essential Splice Site 1026 1156 18 21
ENSDART00000131285   None 126 None 6
ENSDART00000135771 Essential Splice Site 1032 1162 20 23
ENSDART00000136156   None 57 None 6
Genomic Location (Zv9):
Chromosome 23 (position 31008919)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30843809
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTTCCCAGGAGATGACTACATCAGCAAGAAATTCAGGGCAAGTGATG[G/A]TAAGATCAAATATCATCTGCTTCTCTTATTGTGTCCAATTATGTTTATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link