LOC564281

Ensembl ID:
ENSDARG00000074025
Human Orthologue:
C1GALT1
Human Description:
core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 [Source:HGNC Sym
Mouse Orthologue:
C1galt1
Mouse Description:
core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 Gene [Source:MGI

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42818 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42817 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42818
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109900 Essential Splice Site 213 273 4 5
Genomic Location (Zv9):
Chromosome 16 (position 50561000)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47415176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTGTGAGGCCGGTGTCTAGCCATTGAAAATAAAGCCATATCATAGAT[G/T]GCTGTCCCCCCACAATAGCCCCTTTCACACAGTGATACCGGTAAATATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109900 Nonsense 239 273 5 5
Genomic Location (Zv9):
Chromosome 16 (position 50559783)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47413959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCGGATTTTGTGATTTCTTTTCATTATCTGAGAGCTGCAGACATGTA[C/A]ATGCTGGAGTATTATACGTATCACCTGCGACCATTCGGATACAAGTACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Normalized brain volume: Genome-wide association analysis of susceptibility and clinical phenotype in multiple sclerosis. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link