lima1

Ensembl ID:
ENSDARG00000074020
ZFIN ID:
ZDB-GENE-001120-1
Description:
LIM domain and actin binding 1 [Source:RefSeq peptide;Acc:NP_571739]
Human Orthologue:
LIMA1
Human Description:
LIM domain and actin binding 1 [Source:HGNC Symbol;Acc:24636]
Mouse Orthologue:
Lima1
Mouse Description:
LIM domain and actin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1920992]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14742 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14742
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127983 Nonsense 58 589 2 9
Genomic Location:
Chromosome 23 (position 36510174)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACGCCTACATCTCCAGAACCCAAAGCACACCTCCAGWACCATCTGCAA[C/T]AGTCTGCTGTAAAAATCCCACTGGAGTCCACTRACGTCCAKCTTATTRAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rz4z1j9b