lima1

Ensembl ID:
ENSDARG00000074020
ZFIN ID:
ZDB-GENE-001120-1
Description:
LIM domain and actin binding 1 [Source:RefSeq peptide;Acc:NP_571739]
Human Orthologue:
LIMA1
Human Description:
LIM domain and actin binding 1 [Source:HGNC Symbol;Acc:24636]
Mouse Orthologue:
Lima1
Mouse Description:
LIM domain and actin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1920992]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14742 Nonsense Available for shipment Available now
sa39424 Nonsense Mutation detected in F1 DNA During 2016
sa39425 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14742
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127983 Nonsense 58 589 2 9
Genomic Location (Zv9):
Chromosome 23 (position 36510174)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36824037
KASP Assay ID:
2261-8102.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACGCCTACATCTCCAGAACCCAAAGCACACCTCCAGWACCATCTGCAA[C/T]AGTCTGCTGTAAAAATCCCACTGGAGTCCACTRACGTCCAKCTTATTRAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127983 Nonsense 91 589 2 9
Genomic Location (Zv9):
Chromosome 23 (position 36510273)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36824136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCACAGACCAGCAGTGTTTGAGCGACAGTGATCAGCCAATGGAGAAG[C/T]GAACGCAAAGAGATGTGGAGACCCTCATCGAAAAGCCCACCGTCCCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127983 Nonsense 366 589 9 9
Genomic Location (Zv9):
Chromosome 23 (position 36532605)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36364172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGGTCAACGTGCTTGCGGCCACTTTAGAGACCCGGACCCAGGCCACGT[C/A]AGAAAGGGTGGAGAAGCCATTGGAAACGGGACGACTCAAGATCTCCTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link