usp31

Ensembl ID:
ENSDARG00000074017
Human Orthologue:
USP31
Human Description:
ubiquitin specific peptidase 31 [Source:HGNC Symbol;Acc:20060]
Mouse Orthologue:
Usp31
Mouse Description:
ubiquitin specific peptidase 31 Gene [Source:MGI Symbol;Acc:MGI:1923429]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33293 Nonsense Mutation detected in F1 DNA During 2016
sa9970 Nonsense Available for shipment Available now
sa1917 Nonsense F2 line generated During 2016
sa33292 Nonsense Mutation detected in F1 DNA During 2016
sa15246 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33293
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109017 Nonsense 294 1290 5 16
Genomic Location (Zv9):
Chromosome 3 (position 45250845)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47260398
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATTGTCACTTGTCATCCCTCAGGCCTCTGTATGTGACTGTGGTTTAT[C/T]AAGGCAAGTACTCTCACTGCATGAGGATCGGTGTGGCCGTACCGCTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9970
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109017 Nonsense 491 1290 9 16
Genomic Location (Zv9):
Chromosome 3 (position 45247941)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47257494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNNAGATTGGACCCTTYAGTCTGCGAGTTGTYGGAGTGGTTGGAATCACCTA[T/A]CTGCTGCCGCAAGAGGAGCAGCCCCTGTGTCATCCAACTGTGGAAAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1917
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109017 Nonsense 793 1290 15 16
Genomic Location (Zv9):
Chromosome 3 (position 45235137)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47244690
KASP Assay ID:
554-1906.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCCCTGATCTCTCTGGCAGAGTCGGTGGAGTTTCCCGGTGACCGCAGT[G/T]AAGACGATGGTGAGGAACATMAACGTGCTTCTAACATGGATGTTCATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33292
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109017 Nonsense 906 1290 16 16
Genomic Location (Zv9):
Chromosome 3 (position 45234489)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47244042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCGTTGGCCATGATGGAGGGTAACGGTAGTGACGATGGTAATGGCAAA[C/T]GAATCCTAGACGAGGCTTACTGCCGAGCTCCACTACAGGCTGACAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15246
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109017 Nonsense 1001 1290 16 16
Genomic Location (Zv9):
Chromosome 3 (position 45234204)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47243757
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACCTCCTCYGTTACAAAATCTCCATCCTCCCAAGTGTCTTCCAGCCCT[C/T]AAGTGAAGGGCACCAAAACGACCAATCTAAAAGAAAAGAGCAATTCTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link