LOC558330

Ensembl ID:
ENSDARG00000073999
Human Orthologue:
TAPT1
Human Description:
transmembrane anterior posterior transformation 1 [Source:HGNC Symbol;Acc:26887]
Mouse Orthologue:
Tapt1
Mouse Description:
transmembrane anterior posterior transformation 1 Gene [Source:MGI Symbol;Acc:MGI:2683537]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22549 Nonsense Mutation detected in F1 DNA During 2014
sa24968 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22548 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22549
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113285 Nonsense 199 577 4 14
Genomic Location:
Chromosome 14 (position 49587125)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGCCATGATGTACCATCTGATCCGAGGCCAGTCAGTCATCAAACTCTA[C/A]ATCATCTACAACATGCTGGAGGTACCATACTAATGCCCTCACACCTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24968
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113285 Essential Splice Site 440 577 12 14
Genomic Location:
Chromosome 14 (position 49573946)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCCAGGGCGCTCTCTCTTCTGTCTGTCTGCTCCTCTTTTATCTCGGG[T/C]AAAACGAATTACCTAAAAGTGTGTTGGCATCACATAATGTGTAATTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22548
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113285 Nonsense 459 577 13 14
Genomic Location:
Chromosome 14 (position 49572072)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGAAAGTGTTGAATAGTATCATTATTCTGGGAAAGTCCTGTCGCTA[T/A]GTAAAAGAAGCTAAAATGGAGGGTAAGCTGTTTGAAAGACCAAACCCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/if4ra149