si:ch211-23l10.3

Ensembl ID:
ENSDARG00000073998
ZFIN ID:
ZDB-GENE-091204-25
Human Orthologue:
TRIOBP
Human Description:
TRIO and F-actin binding protein [Source:HGNC Symbol;Acc:17009]
Mouse Orthologue:
Triobp
Mouse Description:
TRIO and F-actin binding protein Gene [Source:MGI Symbol;Acc:MGI:1349410]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17393 Nonsense Available for shipment Available now
sa31314 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17393
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115079 Nonsense 368 1035 1 9
ENSDART00000142099   None 622 None 19
Genomic Location (Zv9):
Chromosome 3 (position 16106542)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16336761
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACTTCAGACAGAAWTTCAGACAAGGTTAAGTTCTCGCTTCATGATGAT[G/T]GAAGTCCAGGGAACAGTCTGCACATGGCCAGCAGAGTGTTGTCAAMGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31314
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115079 Nonsense 477 1035 1 9
ENSDART00000142099   None 622 None 19
Genomic Location (Zv9):
Chromosome 3 (position 16106215)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16336434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGGCCTACCTCCTACATACCCTTCACACTCATTACTTAAAGGAGCAA[C/T]AGCCTTGGCCAGTGACTGAAAGTTTCTCGCCTGGAACCAAAATTGCAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link