prickle3

Ensembl ID:
ENSDARG00000073996
ZFIN ID:
ZDB-GENE-081105-86
Description:
Novel protein similar to H.sapiens LMO6, LIM domain only 6 (LMO6) [Source:UniProtKB/TrEMBL;Acc:B0S6H
Human Orthologue:
PRICKLE3
Human Description:
prickle homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:6645]
Mouse Orthologue:
Prickle3
Mouse Description:
prickle homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1859635]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16475 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16475
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113159 Nonsense 126 783 4 11
ENSDART00000147020 Nonsense 126 353 4 8
Genomic Location (Zv9):
Chromosome 8 (position 51510758)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49261145
KASP Assay ID:
2260-1147.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATTCCTGAGGACAAGRTTCCCTACGTCAACAGTCCAGGAGAGCGATA[T/A]CGTATCAAGCAGCTTYTRCACCAGCTGCCGGCCCATGACAGYGAGGTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link