mntb

Ensembl ID:
ENSDARG00000073988
ZFIN ID:
ZDB-GENE-070820-8
Description:
MAX binding protein b [Source:RefSeq peptide;Acc:NP_001096581]
Human Orthologue:
MNT
Human Description:
MAX binding protein [Source:HGNC Symbol;Acc:7188]
Mouse Orthologue:
Mnt
Mouse Description:
max binding protein Gene [Source:MGI Symbol;Acc:MGI:109150]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14759 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14759
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114825 Nonsense 21 552 1 6
ENSDART00000123970 Nonsense 21 572 1 7
Genomic Location:
Chromosome 21 (position 38297618)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACCTTATTGGAGGMGGCCAGGTATTTGGAGTGGCAAGCCCAGCAACAA[C/T]AGATTACACGTGGTAAGGCGGGGGGGAMGTKGGTGATTGCATAGATAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u43lqvtm