LOC794003

Ensembl ID:
ENSDARG00000073976
Human Orthologues:
ZP1, ZP4
Human Descriptions:
zona pellucida glycoprotein 1 (sperm receptor) [Source:HGNC Symbol;Acc:13187]
zona pellucida glycoprotein 4 [Source:HGNC Symbol;Acc:15770]
Mouse Orthologue:
Zp1
Mouse Description:
zona pellucida glycoprotein 1 Gene [Source:MGI Symbol;Acc:MGI:103073]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19555 Nonsense Mutation detected in F1 DNA During 2014
sa6601 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19555
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114006 Nonsense 404 1036 7 19
Genomic Location:
Chromosome 1 (position 45772528)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATGTTTCCCCATCATCATCATCATCATCATCACCGTCATCGTCATTA[T/A]CCTGCACCTCCTGTGGATGCTCTTCCCAAATTTTCAATAAAGCCATATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114006 Nonsense 528 1036 8 19
Genomic Location:
Chromosome 1 (position 45772067)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGYTCTTCTYATAATATTYGTAAAGATGTGGAGACAAAAGAATGGATCT[C/A]GATTTCATCGGTGTCCGCTGCCTGTAACTACAACCTTCGCTCTGTAGGGR
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j7m65ut0