LOC794003

Ensembl ID:
ENSDARG00000073976
Human Orthologues:
ZP1, ZP4
Human Descriptions:
zona pellucida glycoprotein 1 (sperm receptor) [Source:HGNC Symbol;Acc:13187]
zona pellucida glycoprotein 4 [Source:HGNC Symbol;Acc:15770]
Mouse Orthologue:
Zp1
Mouse Description:
zona pellucida glycoprotein 1 Gene [Source:MGI Symbol;Acc:MGI:103073]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39675 Essential Splice Site Mutation detected in F1 DNA During 2016
sa19555 Nonsense Available for shipment Available now
sa6601 Nonsense Mutation detected in F1 DNA During 2016
sa39674 Nonsense Mutation detected in F1 DNA During 2016
sa39673 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39675
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114006 Essential Splice Site 140 1036 1 19
Genomic Location (Zv9):
Chromosome 1 (position 45778402)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44621531
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAACGAGCATCTGTTATCGAGGACGGATTTCAAGGCGATGCTCCAGG[T/C]AAGATTTCCTGTTTTATAATTATGTATGGTCGAGTGGGAATAAAGTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114006 Nonsense 404 1036 7 19
Genomic Location (Zv9):
Chromosome 1 (position 45772528)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44615657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATGTTTCCCCATCATCATCATCATCATCATCACCGTCATCGTCATTA[T/A]CCTGCACCTCCTGTGGATGCTCTTCCCAAATTTTCAATAAAGCCATATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114006 Nonsense 528 1036 8 19
Genomic Location (Zv9):
Chromosome 1 (position 45772067)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44615196
KASP Assay ID:
554-4813.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGYTCTTCTYATAATATTYGTAAAGATGTGGAGACAAAAGAATGGATCT[C/A]GATTTCATCGGTGTCCGCTGCCTGTAACTACAACCTTCGCTCTGTAGGGR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114006 Nonsense 538 1036 8 19
Genomic Location (Zv9):
Chromosome 1 (position 45772036)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44615165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACAAAAGAATGGATCTCGATTTCATCGGTGTCCGCTGCCTGTAACTA[C/A]AACCTTCGCTCTGTAGGGGATAATGTTGTGCTCTCTTCACCACTCCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114006 Essential Splice Site 857 1036 14 19
Genomic Location (Zv9):
Chromosome 1 (position 45766196)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44609325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCCCTCAGTCTAAATTACGGCACAATCACCAGAGATTCGCCTGTAAG[G/A]TACATGTAGTAATTCAGTTACACTGGTTCTCAAACAACCGAGCAGCATTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link