ENSDARG00000073975

Ensembl ID:
ENSDARG00000073975
Human Orthologues:
CUL7, CUL9
Human Descriptions:
cullin 7 [Source:HGNC Symbol;Acc:21024]
cullin 9 [Source:HGNC Symbol;Acc:15982]
Mouse Orthologues:
Cul7, Cul9
Mouse Descriptions:
cullin 7 Gene [Source:MGI Symbol;Acc:MGI:1913765]
cullin 9 Gene [Source:MGI Symbol;Acc:MGI:1925559]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31120 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31120
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112264 Nonsense 464 788 8 14
Genomic Location (Zv9):
Chromosome Zv9_NA395 (position 3862)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150118.1 3862
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCTCTTCATCCACACTTAGGTCGTTCAGCAGTTCATCCGTTTCCTGTA[T/A]CGACTCGCATCTCTGAATAAAGACTACGCTGTTGTGATGTGTCGTCTGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link