glt25d1

Ensembl ID:
ENSDARG00000073974
ZFIN ID:
ZDB-GENE-070720-6
Human Orthologue:
GLT25D1
Human Description:
glycosyltransferase 25 domain containing 1 [Source:HGNC Symbol;Acc:26182]
Mouse Orthologue:
Glt25d1
Mouse Description:
glycosyltransferase 25 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1924348]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25261 Nonsense Mutation detected in F1 DNA During 2017
sa33311 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25261
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114521 Nonsense 413 623 9 12
Genomic Location (Zv9):
Chromosome 3 (position 53363418)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52470733
KASP Assay ID:
554-7725.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGTGACCCTTATCACGGCAGACCTCTCACTAAAGGAGAGCTGGGCTG[C/A]TTCCTGTCCCACTATAACATCTGGAAAGAGGTCTGGCACACATCCCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33311
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114521 Nonsense 418 623 9 12
Genomic Location (Zv9):
Chromosome 3 (position 53363433)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52470748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGGCAGACCTCTCACTAAAGGAGAGCTGGGCTGCTTCCTGTCCCACTA[T/A]AACATCTGGAAAGAGGTCTGGCACACATCCCTGTTTGTTGTTTGGCTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link