si:dkey-202b22.5

Ensembl ID:
ENSDARG00000073965
ZFIN ID:
ZDB-GENE-041210-175
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RH03]
Human Orthologue:
C12orf63
Human Description:
chromosome 12 open reading frame 63 [Source:HGNC Symbol;Acc:24777]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20256 Nonsense Available for shipment Available now
sa2158 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa20256
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036401 Nonsense 391 1085 9 28
ENSDART00000110028 Nonsense 99 279 3 7
ENSDART00000135276   None 188 None 4
Genomic Location (Zv9):
Chromosome 4 (position 17548590)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18491430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCACACTCCTGCTGGACTAAAGCTCTAGACTGTGCTCTTCAAAGCTA[T/A]GGAGTTCTGGAGTCTTGGGATGGAGACACCTGGGGCAGCAGTTCGTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2158
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036401 Essential Splice Site 431 1085 9 28
ENSDART00000110028 Essential Splice Site 139 279 3 7
ENSDART00000135276   None 188 None 4
Genomic Location (Zv9):
Chromosome 4 (position 17548711)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18491551
KASP Assay ID:
554-2836.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATATGGGGCTGTCTCCAGGGAGCTGTGCTTTCAGCCAAGATCGCACAG[T/C]GAGTGAAAACCCAAAAGGTGTTTTTGAGACAGCTTTCCATTACAGCTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link