si:ch211-258f14.2

Ensembl ID:
ENSDARG00000073963
ZFIN ID:
ZDB-GENE-070705-151
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A5I8]
Human Orthologue:
C12orf56
Human Description:
chromosome 12 open reading frame 56 [Source:HGNC Symbol;Acc:26967]
Mouse Orthologue:
D930020B18Rik
Mouse Description:
RIKEN cDNA D930020B18 gene Gene [Source:MGI Symbol;Acc:MGI:2442001]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa418 Nonsense Available for shipment Available now
sa33368 Nonsense Mutation detected in F1 DNA During 2017
sa40210 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109609 Nonsense 451 591 10 13
ENSDART00000133973 Nonsense 437 577 9 12
Genomic Location (Zv9):
Chromosome 4 (position 4635811)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4753992
KASP Assay ID:
554-0279.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAATGAAAAGTCTTTGTGTTTGGCAGCTGCAGAGTCTGCAGGCGGACTA[T/A]CTGGATGCAGCATCTGCTCTGCTGTTTGAGGTGGTTGTGCTATGTCAGGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa33368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109609 Nonsense 500 591 12 13
ENSDART00000133973 Nonsense 486 577 11 12
Genomic Location (Zv9):
Chromosome 4 (position 4633967)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4752148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCTTTAGCTAATGGGTTTATCTCCATCTCAGCTCCCATTTGTTGGATA[T/A]CAGGCCCAACAGACGGTTCTGGTTCTCTCAGGCCCGCAGTTTCCCATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40210
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109609 Nonsense 541 591 12 13
ENSDART00000133973 Nonsense 527 577 11 12
Genomic Location (Zv9):
Chromosome 4 (position 4633845)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4752026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACCAGCGATGCTGTGTTTTATTAGCCTGTCTGCAGCACAGCCCCTGTT[T/A]GAGCAAATACATCAGGACAGGATTCAAGGAGGAGTTCAGGTCCTTCATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link